Transcript: Human NM_018247.4

Homo sapiens transmembrane protein 30A (TMEM30A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
TMEM30A (55754)
Length:
4418
CDS:
155..1240

Additional Resources:

NCBI RefSeq record:
NM_018247.4
NBCI Gene record:
TMEM30A (55754)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018247.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087889 CGGATGATCTTGAGCACTATT pLKO.1 1079 CDS 100% 13.200 18.480 N Tmem30a n/a
2 TRCN0000317704 CGGATGATCTTGAGCACTATT pLKO_005 1079 CDS 100% 13.200 18.480 N Tmem30a n/a
3 TRCN0000161873 GACAACCTGGAAGAACGATTT pLKO.1 815 CDS 100% 10.800 15.120 N TMEM30A n/a
4 TRCN0000353051 GACAACCTGGAAGAACGATTT pLKO_005 815 CDS 100% 10.800 15.120 N TMEM30A n/a
5 TRCN0000163127 GCTGGCCGATACTCTTTGAAT pLKO.1 1016 CDS 100% 5.625 7.875 N TMEM30A n/a
6 TRCN0000164120 CTGGGAGTTGTACTGCTAGTA pLKO.1 1169 CDS 100% 4.950 6.930 N TMEM30A n/a
7 TRCN0000344216 CTGGGAGTTGTACTGCTAGTA pLKO_005 1169 CDS 100% 4.950 6.930 N TMEM30A n/a
8 TRCN0000319509 GAGTTGTACTGCTAGTAATTA pLKO_005 1173 CDS 100% 15.000 12.000 N Tmem30a n/a
9 TRCN0000158914 CATACAATTACCCTGTACATT pLKO.1 1041 CDS 100% 5.625 4.500 N TMEM30A n/a
10 TRCN0000159317 GCCTGTTTACTCAGAGTTTAT pLKO.1 2645 3UTR 100% 13.200 9.240 N TMEM30A n/a
11 TRCN0000344295 GCCTGTTTACTCAGAGTTTAT pLKO_005 2645 3UTR 100% 13.200 9.240 N TMEM30A n/a
12 TRCN0000162477 CCCAACTCACTTGGAATGTTT pLKO.1 1943 3UTR 100% 5.625 3.938 N TMEM30A n/a
13 TRCN0000160267 CAGTAGTAATACAGCTGACAT pLKO.1 1210 CDS 100% 4.950 3.465 N TMEM30A n/a
14 TRCN0000344217 CAGTAGTAATACAGCTGACAT pLKO_005 1210 CDS 100% 4.950 3.465 N TMEM30A n/a
15 TRCN0000158792 GAGATTCTAGTGCTTTGCTTA pLKO.1 588 CDS 100% 4.950 3.465 N TMEM30A n/a
16 TRCN0000344294 GAGATTCTAGTGCTTTGCTTA pLKO_005 588 CDS 100% 4.950 3.465 N TMEM30A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018247.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03649 pDONR223 100% 90% 90% None 235_342del n/a
2 ccsbBroad304_03649 pLX_304 0% 90% 90% V5 235_342del n/a
3 TRCN0000467656 GTTGGCCCCAGAGGCCTTATAGCA pLX_317 31.7% 90% 90% V5 235_342del n/a
Download CSV