Transcript: Human NM_018271.4

Homo sapiens threonine synthase like 2 (THNSL2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
THNSL2 (55258)
Length:
1985
CDS:
13..1467

Additional Resources:

NCBI RefSeq record:
NM_018271.4
NBCI Gene record:
THNSL2 (55258)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018271.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162973 GAGCCGATCAAGACTGTGTTT pLKO.1 610 CDS 100% 4.950 6.930 N THNSL2 n/a
2 TRCN0000120103 GCTGCCATTGAGAGTGTTCAA pLKO.1 454 CDS 100% 4.950 6.930 N Thnsl2 n/a
3 TRCN0000163103 GCTGCCATTGAGAGTGTTCAA pLKO.1 454 CDS 100% 4.950 6.930 N THNSL2 n/a
4 TRCN0000163285 GACAACTGGATGCTGATGCTT pLKO.1 1384 CDS 100% 3.000 2.400 N THNSL2 n/a
5 TRCN0000161397 GCTGTTAAATCAACCTTGGCA pLKO.1 925 CDS 100% 0.750 0.600 N THNSL2 n/a
6 TRCN0000160764 CAAAGGTCACTGCACAAAGAT pLKO.1 510 CDS 100% 5.625 3.938 N THNSL2 n/a
7 TRCN0000161914 GTCTGAGCTGTAGTGAAAGTT pLKO.1 1712 3UTR 100% 5.625 3.938 N THNSL2 n/a
8 TRCN0000160730 CACAATCTGATGAGCCTGAAT pLKO.1 655 CDS 100% 4.950 3.465 N THNSL2 n/a
9 TRCN0000163657 GAAAGTTTCAGGGCCTGCAAA pLKO.1 1726 3UTR 100% 4.950 3.465 N THNSL2 n/a
10 TRCN0000163783 GCACAATCTGATGAGCCTGAA pLKO.1 654 CDS 100% 4.050 2.835 N THNSL2 n/a
11 TRCN0000160470 CTGTTAAATCAACCTTGGCAT pLKO.1 926 CDS 100% 2.640 1.848 N THNSL2 n/a
12 TRCN0000163039 GAGCAGTTTGAAAGGACCCAA pLKO.1 1036 CDS 100% 2.640 1.848 N THNSL2 n/a
13 TRCN0000162816 CCAAAGTGTGAATCTGCCCAA pLKO.1 1053 CDS 100% 2.160 1.512 N THNSL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018271.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.