Transcript: Human NM_018322.3

Homo sapiens SAYSVFN motif domain containing 1 (SAYSD1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
SAYSD1 (55776)
Length:
2018
CDS:
98..649

Additional Resources:

NCBI RefSeq record:
NM_018322.3
NBCI Gene record:
SAYSD1 (55776)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018322.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435328 CTGTGGGTCCGACGCAATTTA pLKO_005 850 3UTR 100% 15.000 21.000 N SAYSD1 n/a
2 TRCN0000414578 GCGCCTACTCTGTGTTCAATC pLKO_005 546 CDS 100% 10.800 15.120 N SAYSD1 n/a
3 TRCN0000420953 AGCAGTTTGAAGTATGATTAG pLKO_005 983 3UTR 100% 10.800 8.640 N SAYSD1 n/a
4 TRCN0000150164 GCTGCTTGAGTTGTTTCTTAT pLKO.1 1403 3UTR 100% 13.200 9.240 N SAYSD1 n/a
5 TRCN0000131041 CTGGAATTTGGCCTGGCATAT pLKO.1 452 CDS 100% 10.800 7.560 N SAYSD1 n/a
6 TRCN0000146868 CCATTGGCTATGGATTTGATT pLKO.1 698 3UTR 100% 5.625 3.938 N SAYSD1 n/a
7 TRCN0000147694 GACCAATATCACCTTCTTGAA pLKO.1 391 CDS 100% 4.950 3.465 N SAYSD1 n/a
8 TRCN0000127980 GACTGTTTGTGGAACTGGAAT pLKO.1 438 CDS 100% 4.950 3.465 N SAYSD1 n/a
9 TRCN0000418063 GTTGGAGCGCGAGTTACAGTT pLKO_005 607 CDS 100% 4.950 3.465 N SAYSD1 n/a
10 TRCN0000146376 CCTGTCCTTGTTCTATTGGAT pLKO.1 478 CDS 100% 3.000 2.100 N SAYSD1 n/a
11 TRCN0000149701 GCAGTTCACAATACGGTTCTA pLKO.1 1584 3UTR 100% 4.950 2.970 N SAYSD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018322.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03654 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03654 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474592 GTGCGCGTACCGCTTAACCACACT pLX_317 100% 100% 100% V5 n/a
Download CSV