Transcript: Human NM_018402.2

Homo sapiens interleukin 26 (IL26), mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
IL26 (55801)
Length:
1066
CDS:
55..570

Additional Resources:

NCBI RefSeq record:
NM_018402.2
NBCI Gene record:
IL26 (55801)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018402.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426269 AGCTGTTGACGCTCTCTATAT pLKO_005 174 CDS 100% 13.200 18.480 N IL26 n/a
2 TRCN0000372646 AGTACATTGTGTCAACTTAAT pLKO_005 815 3UTR 100% 13.200 18.480 N IL26 n/a
3 TRCN0000058629 CGATTCCAGAAGACCGCATAA pLKO.1 218 CDS 100% 10.800 8.640 N IL26 n/a
4 TRCN0000058631 GCCATCAGTGAACTGGATATT pLKO.1 508 CDS 100% 13.200 9.240 N IL26 n/a
5 TRCN0000058632 CGCTTTGTGGAGGACTTTCAT pLKO.1 370 CDS 100% 5.625 3.938 N IL26 n/a
6 TRCN0000058628 GCAGAAATTGAGCCACTGTAT pLKO.1 399 CDS 100% 4.950 3.465 N IL26 n/a
7 TRCN0000058630 GCATGGCTCAAAGCAACGATT pLKO.1 202 CDS 100% 4.950 3.465 N IL26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018402.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03657 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03657 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472358 ACACCTGAGCCGTCGGACGTTTCT pLX_317 83.1% 100% 100% V5 n/a
4 ccsbBroadEn_15914 pDONR223 0% 99.8% 100% None 447C>T n/a
5 ccsbBroad304_15914 pLX_304 0% 99.8% 100% V5 447C>T n/a
6 TRCN0000468909 TCATATCCATTCTCGCAACAAAGA pLX_317 79.5% 99.8% 100% V5 447C>T n/a
Download CSV