Transcript: Human NM_018403.7

Homo sapiens decapping mRNA 1A (DCP1A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
DCP1A (55802)
Length:
5926
CDS:
27..1775

Additional Resources:

NCBI RefSeq record:
NM_018403.7
NBCI Gene record:
DCP1A (55802)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018403.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021010 CCATTGTGAATCGACTAAATA pLKO.1 229 CDS 100% 15.000 21.000 N DCP1A n/a
2 TRCN0000235901 GGGATTCTTGAATCGAAATTA pLKO_005 3655 3UTR 100% 15.000 21.000 N DCP1A n/a
3 TRCN0000235899 ACCATTGTGAATCGACTAAAT pLKO_005 228 CDS 100% 13.200 18.480 N DCP1A n/a
4 TRCN0000021009 CGACTAAATATGCACAATCTA pLKO.1 240 CDS 100% 5.625 7.875 N DCP1A n/a
5 TRCN0000235902 ATGCAAGCTTGTCGATATATA pLKO_005 322 CDS 100% 15.000 10.500 N DCP1A n/a
6 TRCN0000235898 TGATATAGAAGGGACCTTATT pLKO_005 170 CDS 100% 13.200 9.240 N DCP1A n/a
7 TRCN0000235900 TTGTGCAGCCTAAGGTGTTAT pLKO_005 1441 CDS 100% 13.200 9.240 N DCP1A n/a
8 TRCN0000021012 CCATTTCCCTTTGAGCAGTTA pLKO.1 801 CDS 100% 4.950 3.465 N DCP1A n/a
9 TRCN0000021013 CGGTAGAAGAGTTATTTGGAA pLKO.1 679 CDS 100% 3.000 2.100 N DCP1A n/a
10 TRCN0000096668 GCAGGTTCTGACCAAGAACAA pLKO.1 1736 CDS 100% 0.495 0.347 N Dcp1a n/a
11 TRCN0000021011 CTGAAGTATTTGTGCAGCCTA pLKO.1 1432 CDS 100% 2.640 1.584 N DCP1A n/a
12 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 4606 3UTR 100% 13.200 6.600 Y IQCC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018403.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03658 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03658 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479675 ATTATTACCGATCCATTACTGACG pLX_317 18.8% 100% 100% V5 n/a
Download CSV