Transcript: Human NM_018410.5

Homo sapiens Holliday junction recognition protein (HJURP), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
HJURP (55355)
Length:
3157
CDS:
36..2282

Additional Resources:

NCBI RefSeq record:
NM_018410.5
NBCI Gene record:
HJURP (55355)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018410.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122235 GCAAGTATGGAAGTTCGATAT pLKO.1 1869 CDS 100% 10.800 15.120 N HJURP n/a
2 TRCN0000141465 CAAAGTGACACCCTCGAAGTA pLKO.1 1166 CDS 100% 4.950 6.930 N HJURP n/a
3 TRCN0000143078 CCAAGAGCGATTCATCTTCAT pLKO.1 1582 CDS 100% 4.950 6.930 N HJURP n/a
4 TRCN0000141593 CACGTCTTACAGGATGGAAGA pLKO.1 2216 CDS 100% 4.050 5.670 N HJURP n/a
5 TRCN0000142899 CCACTTGCTCTCTGTTTGTAT pLKO.1 2313 3UTR 100% 5.625 3.938 N HJURP n/a
6 TRCN0000144884 GAAGGAATCGTTACGATGAAA pLKO.1 1753 CDS 100% 5.625 3.938 N HJURP n/a
7 TRCN0000121523 CCTCGAAGTATTCTTCCTTGA pLKO.1 1177 CDS 100% 4.050 2.835 N HJURP n/a
8 TRCN0000142140 GAGCACAAAGCCATCAAGCAT pLKO.1 860 CDS 100% 3.000 2.100 N HJURP n/a
9 TRCN0000144040 CCTTTATGTATTGGAGTGTCT pLKO.1 1839 CDS 100% 2.640 1.848 N HJURP n/a
10 TRCN0000144237 CAGGGAAATAGTTCTGGAATA pLKO.1 1668 CDS 100% 10.800 6.480 N HJURP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018410.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12210 pDONR223 100% 64.3% 64.3% None 1_798del;884C>G n/a
2 ccsbBroad304_12210 pLX_304 0% 64.3% 64.3% V5 1_798del;884C>G n/a
3 TRCN0000470697 CTTTGAGGAACCTTACTGTCCGGT pLX_317 30% 64.3% 64.3% V5 1_798del;884C>G n/a
Download CSV