Transcript: Human NM_018413.6

Homo sapiens carbohydrate sulfotransferase 11 (CHST11), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CHST11 (50515)
Length:
5734
CDS:
465..1523

Additional Resources:

NCBI RefSeq record:
NM_018413.6
NBCI Gene record:
CHST11 (50515)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018413.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035914 CGAAGTCTACAAACTCGATTT pLKO.1 1457 CDS 100% 10.800 15.120 N CHST11 n/a
2 TRCN0000432550 GAAATCAACCACCGCTTGAAA pLKO_005 975 CDS 100% 5.625 7.875 N CHST11 n/a
3 TRCN0000035915 CGATGTCAAATTCGAGGAGTT pLKO.1 1163 CDS 100% 4.050 5.670 N CHST11 n/a
4 TRCN0000424427 CTGGAAGAGGATTCTAATTAC pLKO_005 1308 CDS 100% 13.200 9.240 N CHST11 n/a
5 TRCN0000035917 CCTATGCAAAGTCTACGAGAA pLKO.1 1372 CDS 100% 4.050 2.835 N CHST11 n/a
6 TRCN0000035916 GCAGGAACTCTACAACCCAAT pLKO.1 644 CDS 100% 4.050 2.835 N CHST11 n/a
7 TRCN0000035918 CTGGTCATCTTCTATTTCCAA pLKO.1 546 CDS 100% 3.000 2.100 N CHST11 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5202 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018413.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000470969 AGCATCCGTTTTTAGTTGCCCGCT pLX_317 34.5% 99.9% 100% V5 1038A>C n/a
2 ccsbBroadEn_08177 pDONR223 100% 99.8% 99.4% None 1038A>N;1053G>N n/a
3 ccsbBroad304_08177 pLX_304 0% 99.8% 99.4% V5 1038A>N;1053G>N n/a
Download CSV