Transcript: Human NM_018427.4

Homo sapiens RRN3 homolog, RNA polymerase I transcription factor (RRN3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
RRN3 (54700)
Length:
3796
CDS:
103..2058

Additional Resources:

NCBI RefSeq record:
NM_018427.4
NBCI Gene record:
RRN3 (54700)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018427.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434883 TGTAGATGGTAAGGTTGATAA pLKO_005 1092 CDS 100% 13.200 18.480 N RRN3 n/a
2 TRCN0000417134 CCCAGAATGATACCGTGATTG pLKO_005 1943 CDS 100% 10.800 15.120 N RRN3 n/a
3 TRCN0000015218 CGCGACCTGATAAACATCTTT pLKO.1 1135 CDS 100% 5.625 4.500 N RRN3 n/a
4 TRCN0000015219 GAAGATGATGACTTTCTGAAA pLKO.1 1912 CDS 100% 4.950 3.465 N RRN3 n/a
5 TRCN0000015220 CAAGCTCCTTTGACACGCATT pLKO.1 1973 CDS 100% 4.050 2.835 N RRN3 n/a
6 TRCN0000015222 CTGTAGTTTCAAATTGGGATT pLKO.1 1215 CDS 100% 4.050 2.835 N RRN3 n/a
7 TRCN0000015221 GCAAGATATGTACCATCGACA pLKO.1 682 CDS 100% 2.640 1.584 N RRN3 n/a
8 TRCN0000017979 GCTGCACATATACCTTAATAA pLKO.1 1398 CDS 100% 15.000 7.500 Y RRN3P1 n/a
9 TRCN0000017980 GCTGTGTTCTACACCTTTGTT pLKO.1 1486 CDS 100% 5.625 2.813 Y RRN3P1 n/a
10 TRCN0000017982 CGGAAACCTGAAAGAAGGTTT pLKO.1 1530 CDS 100% 0.495 0.248 Y RRN3P1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018427.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03446 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03446 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468173 TCTGCCCTTGTCCTTGCTGCACCC pLX_317 22.4% 100% 100% V5 n/a
Download CSV