Transcript: Human NM_018460.4

Homo sapiens Rho GTPase activating protein 15 (ARHGAP15), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
ARHGAP15 (55843)
Length:
1670
CDS:
63..1490

Additional Resources:

NCBI RefSeq record:
NM_018460.4
NBCI Gene record:
ARHGAP15 (55843)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018460.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429280 GGAAGGTCACTGAACCTATAT pLKO_005 211 CDS 100% 13.200 18.480 N ARHGAP15 n/a
2 TRCN0000047253 CCGTGGAAACACTGAATTCTA pLKO.1 91 CDS 100% 0.000 0.000 N ARHGAP15 n/a
3 TRCN0000418065 GATATTGACTTCATCATATTG pLKO_005 576 CDS 100% 13.200 9.240 N ARHGAP15 n/a
4 TRCN0000047257 GCAAGACAACAACACAAGAAT pLKO.1 1205 CDS 100% 5.625 3.938 N ARHGAP15 n/a
5 TRCN0000047255 GACACCATGAAAGTCCTCTTT pLKO.1 1272 CDS 100% 4.950 3.465 N ARHGAP15 n/a
6 TRCN0000047256 GCTCAGCCAAAGTAAATCCAT pLKO.1 173 CDS 100% 3.000 2.100 N ARHGAP15 n/a
7 TRCN0000047254 CCTCTAGCACTGAATTGCTAA pLKO.1 691 CDS 100% 0.495 0.347 N ARHGAP15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018460.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08597 pDONR223 100% 99.9% 99.7% None 1226T>C n/a
2 ccsbBroad304_08597 pLX_304 0% 99.9% 99.7% V5 1226T>C n/a
3 TRCN0000474228 GGCGATTCGTACCCTCACTGGCGC pLX_317 39.5% 99.9% 99.7% V5 1226T>C n/a
Download CSV