Transcript: Human NM_018649.3

Homo sapiens macroH2A.2 histone (MACROH2A2), mRNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
MACROH2A2 (55506)
Length:
1932
CDS:
215..1333

Additional Resources:

NCBI RefSeq record:
NM_018649.3
NBCI Gene record:
MACROH2A2 (55506)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018649.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303451 GAGTTCTTGGAAACGGTAAAG pLKO_005 932 CDS 100% 10.800 15.120 N MACROH2A2 n/a
2 TRCN0000106906 GCCGAAATTGACCTCAAAGAA pLKO.1 875 CDS 100% 5.625 7.875 N MACROH2A2 n/a
3 TRCN0000299195 GCCGAAATTGACCTCAAAGAA pLKO_005 875 CDS 100% 5.625 7.875 N MACROH2A2 n/a
4 TRCN0000106909 ACAGCCGAAATTGACCTCAAA pLKO.1 872 CDS 100% 4.950 6.930 N MACROH2A2 n/a
5 TRCN0000106907 CCAAACCAAAGGACAGCGATA pLKO.1 693 CDS 100% 4.050 5.670 N MACROH2A2 n/a
6 TRCN0000299147 CCAAACCAAAGGACAGCGATA pLKO_005 693 CDS 100% 4.050 5.670 N MACROH2A2 n/a
7 TRCN0000303452 GAGCCTCCATCTGTAAGGAAG pLKO_005 1496 3UTR 100% 4.050 5.670 N MACROH2A2 n/a
8 TRCN0000371036 AGAGTGACATCAGCCATATTG pLKO_005 816 CDS 100% 13.200 9.240 N MACROH2A2 n/a
9 TRCN0000106908 ACAGCGATAAAGAAGGAACTT pLKO.1 705 CDS 100% 4.950 3.465 N MACROH2A2 n/a
10 TRCN0000106905 CCCTTCACACTCTCCTCCAAA pLKO.1 1474 3UTR 100% 4.950 3.465 N MACROH2A2 n/a
11 TRCN0000371037 TAAATCTTCTGTTCCTCCTTT pLKO_005 1657 3UTR 100% 4.950 3.465 N MACROH2A2 n/a
12 TRCN0000096926 CCAGAGTGACATCAGCCATAT pLKO.1 814 CDS 100% 10.800 6.480 N Macroh2a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018649.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03596 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03596 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478248 CGCGAGTATGCAGGAATCCATCCC pLX_317 24.7% 100% 100% V5 n/a
Download CSV