Transcript: Human NM_018650.5

Homo sapiens microtubule affinity regulating kinase 1 (MARK1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
MARK1 (4139)
Length:
5370
CDS:
688..3075

Additional Resources:

NCBI RefSeq record:
NM_018650.5
NBCI Gene record:
MARK1 (4139)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001149223 GTAATGGAGTTTCTACACCG pXPR_003 GGG 126 5% 2 0.297 MARK1 MARK1 77796
2 BRDN0001146169 AAGACCTCAGGCTAACAGTG pXPR_003 TGG 1330 56% 13 0.1693 MARK1 MARK1 77795
3 BRDN0001147433 AGTCATGGAATACGCGAGTG pXPR_003 GGG 418 18% 5 -0.2869 MARK1 MARK1 77794
4 BRDN0001149474 CAATGCTACGTATCGATCTG pXPR_003 TGG 1534 64% 14 -0.4962 MARK1 MARK1 77793
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018650.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262887 ATTTCGAGAAGTACGAATAAT pLKO_005 999 CDS 100% 15.000 21.000 N MARK1 n/a
2 TRCN0000199037 CGACGCAGCGTTGCTTATAAT pLKO.1 2551 CDS 100% 15.000 21.000 N MARK1 n/a
3 TRCN0000262889 GTCACACTGCCAACCATTAAA pLKO_005 2377 CDS 100% 15.000 21.000 N MARK1 n/a
4 TRCN0000024173 CTGGGACATCTATTGCCTTTA pLKO.1 3014 CDS 100% 10.800 15.120 N Mark1 n/a
5 TRCN0000262890 TTACGAGGGAAGTACCGTATT pLKO_005 1495 CDS 100% 10.800 15.120 N MARK1 n/a
6 TRCN0000006331 GCGGTTCACATGGAGTATGAA pLKO.1 2787 CDS 100% 5.625 7.875 N MARK1 n/a
7 TRCN0000006332 CCTGCTGTATCATATACCAAA pLKO.1 1981 CDS 100% 4.950 6.930 N MARK1 n/a
8 TRCN0000006330 GCAGCACAACAGTTGGATCAA pLKO.1 2072 CDS 100% 4.950 6.930 N MARK1 n/a
9 TRCN0000006328 CCCATGTAGAATTTGCCCTTA pLKO.1 3175 3UTR 100% 4.050 5.670 N MARK1 n/a
10 TRCN0000362163 CTTAATGCAATAAGGTTATAC pLKO_005 3192 3UTR 100% 13.200 10.560 N Mark1 n/a
11 TRCN0000262888 CACTTCTGGTCATCCTATTAA pLKO_005 2355 CDS 100% 15.000 10.500 N MARK1 n/a
12 TRCN0000282457 CCACGGTAGAAACTGATATTT pLKO_005 5059 3UTR 100% 15.000 10.500 N MARK1 n/a
13 TRCN0000196818 GAACGTCAACTGGTATAATAA pLKO.1 2627 CDS 100% 15.000 10.500 N MARK1 n/a
14 TRCN0000196780 GATGAAGTTATGGCTACTTAT pLKO.1 1762 CDS 100% 13.200 9.240 N MARK1 n/a
15 TRCN0000194906 CATTGGAAATTACCGTTTACA pLKO.1 855 CDS 100% 5.625 3.938 N MARK1 n/a
16 TRCN0000006329 GCACGAGATGAAATAAATGAT pLKO.1 1720 CDS 100% 5.625 3.938 N MARK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018650.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.