Transcript: Human NM_018710.3

Homo sapiens phosphatidylinositol-4,5-bisphosphate 4-phosphatase 2 (PIP4P2), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
PIP4P2 (55529)
Length:
2759
CDS:
111..884

Additional Resources:

NCBI RefSeq record:
NM_018710.3
NBCI Gene record:
PIP4P2 (55529)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018710.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136777 CCCAACTGTAGACGGATAATT pLKO.1 465 CDS 100% 15.000 12.000 N PIP4P2 n/a
2 TRCN0000430458 ATGAGTATTCCTAAGTGTTTA pLKO_005 1213 3UTR 100% 13.200 10.560 N PIP4P2 n/a
3 TRCN0000137916 GAGGTTCAACACTCTGGCAAA pLKO.1 608 CDS 100% 4.050 3.240 N PIP4P2 n/a
4 TRCN0000420847 ATGGATTCCATTCTGGTTTAT pLKO_005 970 3UTR 100% 13.200 9.240 N PIP4P2 n/a
5 TRCN0000432978 ATGTTAGATGCCCTTGTAATT pLKO_005 397 CDS 100% 13.200 9.240 N PIP4P2 n/a
6 TRCN0000425932 CCCACCGTACTTGCAAGAAAG pLKO_005 185 CDS 100% 10.800 7.560 N PIP4P2 n/a
7 TRCN0000133794 CCAACAGGCAAGAAATATGTT pLKO.1 381 CDS 100% 5.625 3.938 N PIP4P2 n/a
8 TRCN0000134479 GATTTCGAGCAACCTATGTTT pLKO.1 766 CDS 100% 5.625 3.938 N PIP4P2 n/a
9 TRCN0000134465 GTGTGCCAATCACTAATCAAT pLKO.1 288 CDS 100% 5.625 3.938 N PIP4P2 n/a
10 TRCN0000138125 GCAATGAAGCTACGCCAATCA pLKO.1 352 CDS 100% 4.950 3.465 N PIP4P2 n/a
11 TRCN0000138155 CCACCTCCATATACAGCCATT pLKO.1 225 CDS 100% 4.050 2.835 N PIP4P2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018710.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03601 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03601 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474631 CAAAAGTATCTTTAAGATTCCAAA pLX_317 72.4% 100% 100% V5 n/a
Download CSV