Transcript: Mouse NM_018805.2

Mus musculus heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1 (Hs3st3b1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Hs3st3b1 (54710)
Length:
6004
CDS:
398..1570

Additional Resources:

NCBI RefSeq record:
NM_018805.2
NBCI Gene record:
Hs3st3b1 (54710)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_018805.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098348 CGCGCTACTCACGCTCAGCCA pLKO.1 602 CDS 100% 0.000 0.000 N Hs3st3b1 n/a
2 TRCN0000098345 GCAGGCAAGGATAAGACAGTA pLKO.1 695 CDS 100% 4.950 3.465 N Hs3st3b1 n/a
3 TRCN0000098349 CATGCTTTGCATCTGGCTGTA pLKO.1 511 CDS 100% 4.050 2.835 N Hs3st3b1 n/a
4 TRCN0000098347 CGAGAGCCTGACGTTCCGCAA pLKO.1 1150 CDS 100% 0.000 0.000 Y Hs3st3b1 n/a
5 TRCN0000035817 CAAGCACTTCTACTTCAACAA pLKO.1 1366 CDS 100% 4.950 2.475 Y HS3ST3B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018805.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07518 pDONR223 100% 87.4% 88.4% None (many diffs) n/a
2 ccsbBroad304_07518 pLX_304 0% 87.4% 88.4% V5 (many diffs) n/a
3 TRCN0000480208 AGGTAAGGCCCAATTTCTATAAAT pLX_317 29.9% 87.4% 88.4% V5 (many diffs) n/a
Download CSV