Transcript: Mouse NM_018815.2

Mus musculus nucleoporin 210 (Nup210), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Nup210 (54563)
Length:
7043
CDS:
43..5703

Additional Resources:

NCBI RefSeq record:
NM_018815.2
NBCI Gene record:
Nup210 (54563)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_018815.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313617 TGCAATTACCATCGAAGTATT pLKO_005 1140 CDS 100% 13.200 18.480 N Nup210 n/a
2 TRCN0000101936 CCTTCCAAATTCTTTCGGAAT pLKO.1 2065 CDS 100% 4.050 5.670 N Nup210 n/a
3 TRCN0000379190 GGGACAGCAGTCACCATTATA pLKO_005 5500 CDS 100% 15.000 10.500 N Nup210 n/a
4 TRCN0000313571 CGCCTATCAGTATACCATAAA pLKO_005 1452 CDS 100% 13.200 9.240 N Nup210 n/a
5 TRCN0000374938 GACTATCCTTGTCGCTGTAAA pLKO_005 4131 CDS 100% 13.200 9.240 N Nup210 n/a
6 TRCN0000313616 TCAATGCCTTCTGATCAATAT pLKO_005 865 CDS 100% 13.200 9.240 N Nup210 n/a
7 TRCN0000101935 GCCTTCTTACTGTGATAGTTA pLKO.1 6350 3UTR 100% 5.625 3.938 N Nup210 n/a
8 TRCN0000317115 GCCTTCTTACTGTGATAGTTA pLKO_005 6350 3UTR 100% 5.625 3.938 N Nup210 n/a
9 TRCN0000101938 GCTGACAGATAAGCAACTGAA pLKO.1 4989 CDS 100% 4.950 3.465 N Nup210 n/a
10 TRCN0000101937 CCCACAACAAATCGAGGTCTT pLKO.1 3255 CDS 100% 4.050 2.835 N Nup210 n/a
11 TRCN0000101939 CCCATCTGACAACATCCGAAT pLKO.1 1185 CDS 100% 4.050 2.835 N Nup210 n/a
12 TRCN0000151745 CTGACAACATCCGAATTGAAA pLKO.1 1190 CDS 100% 5.625 3.938 N NUP210 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018815.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11700 pDONR223 100% 43% 43.6% None (many diffs) n/a
2 ccsbBroad304_11700 pLX_304 0% 43% 43.6% V5 (many diffs) n/a
3 TRCN0000479653 GTGGTCTTTTGAGGACCATACCCA pLX_317 10.6% 43% 43.6% V5 (many diffs) n/a
Download CSV