Transcript: Mouse NM_018828.2

Mus musculus formin binding protein 4 (Fnbp4), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Fnbp4 (55935)
Length:
4691
CDS:
88..3321

Additional Resources:

NCBI RefSeq record:
NM_018828.2
NBCI Gene record:
Fnbp4 (55935)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_018828.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183260 GCATACAAAGTTGTCCATTTA pLKO.1 3428 3UTR 100% 13.200 18.480 N Fnbp4 n/a
2 TRCN0000240899 GTGCGTAGGATTATGTCTAAA pLKO_005 1585 CDS 100% 13.200 18.480 N Fnbp4 n/a
3 TRCN0000219465 TAGCGGAGATAGACGCCATAA pLKO.1 683 CDS 100% 10.800 15.120 N Fnbp4 n/a
4 TRCN0000219466 AGGGATCATAGACGATATTTC pLKO.1 2068 CDS 100% 13.200 10.560 N Fnbp4 n/a
5 TRCN0000240900 ACGGTTCATGAATATTGATTA pLKO_005 141 CDS 100% 13.200 9.240 N Fnbp4 n/a
6 TRCN0000240901 ACTGCTGCTTCCAGTAGTAAA pLKO_005 1087 CDS 100% 13.200 9.240 N Fnbp4 n/a
7 TRCN0000240902 AGTAATACAAAGCTGATTATG pLKO_005 4445 3UTR 100% 13.200 9.240 N Fnbp4 n/a
8 TRCN0000240903 AGAGTATCCAGCGGGAGTTAG pLKO_005 3119 CDS 100% 10.800 7.560 N Fnbp4 n/a
9 TRCN0000180100 CTGTGCTTACTTGGTGCTTAT pLKO.1 556 CDS 100% 10.800 7.560 N Fnbp4 n/a
10 TRCN0000180705 GCCCATTCTTAGTTGTTCCAA pLKO.1 4204 3UTR 100% 3.000 2.100 N Fnbp4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018828.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11727 pDONR223 100% 80.7% 81.7% None (many diffs) n/a
2 ccsbBroad304_11727 pLX_304 0% 80.7% 81.7% V5 (many diffs) n/a
3 TRCN0000466495 TAGCATGCCGCTCCATGATTCCGC pLX_317 10.6% 80.7% 81.7% V5 (many diffs) n/a
Download CSV