Transcript: Human NM_018847.4

Homo sapiens kelch like family member 9 (KLHL9), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
KLHL9 (55958)
Length:
5740
CDS:
546..2399

Additional Resources:

NCBI RefSeq record:
NM_018847.4
NBCI Gene record:
KLHL9 (55958)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018847.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377273 ACGAAAGGTTGCCAAGTATTA pLKO_005 2759 3UTR 100% 13.200 18.480 N KLHL9 n/a
2 TRCN0000335936 GTACGTCATGGGTGATCTAAT pLKO_005 2423 3UTR 100% 13.200 18.480 N KLHL9 n/a
3 TRCN0000335937 CCCGTTACCAGCATGGTATTG pLKO_005 1552 CDS 100% 10.800 15.120 N KLHL9 n/a
4 TRCN0000005851 CCAGCATGGTATTGCTGTCAT pLKO.1 1559 CDS 100% 0.495 0.693 N KLHL9 n/a
5 TRCN0000005849 CCCTGTTCACAGAGCTATGAT pLKO.1 734 CDS 100% 5.625 4.500 N KLHL9 n/a
6 TRCN0000335851 TTGACCCAGATACAGATAAAT pLKO_005 1942 CDS 100% 15.000 10.500 N KLHL9 n/a
7 TRCN0000369066 AGACAATACCTGCGTGAATTT pLKO_005 1331 CDS 100% 13.200 9.240 N KLHL9 n/a
8 TRCN0000369065 CTATGTTGTTGGTGGATATTC pLKO_005 2186 CDS 100% 13.200 9.240 N KLHL9 n/a
9 TRCN0000335938 TGCTAACACCTACAATCTTAT pLKO_005 1025 CDS 100% 13.200 9.240 N KLHL9 n/a
10 TRCN0000005848 CCGTTTCTATTCAAATGGAAA pLKO.1 3113 3UTR 100% 4.950 3.465 N KLHL9 n/a
11 TRCN0000005850 CCTGAAGAACTTTCCTGCTTT pLKO.1 1076 CDS 100% 4.950 3.465 N KLHL9 n/a
12 TRCN0000005852 GTCCAGAAATATGACCCAGAA pLKO.1 2235 CDS 100% 4.050 2.835 N KLHL9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018847.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08613 pDONR223 100% 99.9% 100% None 459C>T n/a
2 ccsbBroad304_08613 pLX_304 0% 99.9% 100% V5 459C>T n/a
3 TRCN0000480620 CGGATATTAATTAGCAACCTAAAC pLX_317 19.4% 99.9% 100% V5 459C>T n/a
Download CSV