Transcript: Human NM_018944.3

Homo sapiens MIS18 kinetochore protein A (MIS18A), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
MIS18A (54069)
Length:
1546
CDS:
36..737

Additional Resources:

NCBI RefSeq record:
NM_018944.3
NBCI Gene record:
MIS18A (54069)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018944.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129156 GCCGAATCCAAATTGTCCTTT pLKO.1 699 CDS 100% 4.950 6.930 N MIS18A n/a
2 TRCN0000312447 GCCGAATCCAAATTGTCCTTT pLKO_005 699 CDS 100% 4.950 6.930 N MIS18A n/a
3 TRCN0000130290 CTCAGTGTTGAAGCCATTGAA pLKO.1 537 CDS 100% 5.625 3.938 N MIS18A n/a
4 TRCN0000312394 CTCAGTGTTGAAGCCATTGAA pLKO_005 537 CDS 100% 5.625 3.938 N MIS18A n/a
5 TRCN0000130026 GCCCAAGAATCTTGATTACAA pLKO.1 500 CDS 100% 5.625 3.938 N MIS18A n/a
6 TRCN0000312445 GCCCAAGAATCTTGATTACAA pLKO_005 500 CDS 100% 5.625 3.938 N MIS18A n/a
7 TRCN0000129207 CTTCGCTGTGTTTCCTGTAAT pLKO.1 363 CDS 100% 13.200 7.920 N MIS18A n/a
8 TRCN0000312444 CTTCGCTGTGTTTCCTGTAAT pLKO_005 363 CDS 100% 13.200 7.920 N MIS18A n/a
9 TRCN0000129383 GCTTCGCTGTGTTTCCTGTAA pLKO.1 362 CDS 100% 4.950 2.970 N MIS18A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018944.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03403 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03403 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480134 CCCCACCACCGTACAAACCTCGAG pLX_317 53.5% 100% 100% V5 n/a
Download CSV