Transcript: Human NM_018959.4

Homo sapiens DAZ associated protein 1 (DAZAP1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
DAZAP1 (26528)
Length:
2184
CDS:
189..1412

Additional Resources:

NCBI RefSeq record:
NM_018959.4
NBCI Gene record:
DAZAP1 (26528)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018959.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164245 CCCAGGAGCGATAACAGTAAA pLKO.1 501 CDS 100% 13.200 18.480 N DAZAP1 n/a
2 TRCN0000275261 CGGAGGTAGTCATGATCTATG pLKO_005 607 CDS 100% 10.800 15.120 N DAZAP1 n/a
3 TRCN0000275258 ACGATGTATACTGGCTTATTT pLKO_005 1810 3UTR 100% 15.000 12.000 N DAZAP1 n/a
4 TRCN0000159197 GAAGAAATCTACTGAGTGTAT pLKO.1 1945 3UTR 100% 4.950 3.960 N DAZAP1 n/a
5 TRCN0000375447 GGTTCAACAACAGGGTTTAAA pLKO_005 1628 3UTR 100% 15.000 10.500 N Dazap1 n/a
6 TRCN0000162537 CCAGGAGCGATAACAGTAAAT pLKO.1 502 CDS 100% 13.200 9.240 N DAZAP1 n/a
7 TRCN0000275260 CCAGGAGCGATAACAGTAAAT pLKO_005 502 CDS 100% 13.200 9.240 N DAZAP1 n/a
8 TRCN0000158588 CAGGGAATACTTCAAGAAGTT pLKO.1 575 CDS 100% 4.950 3.465 N DAZAP1 n/a
9 TRCN0000275259 CAGGGAATACTTCAAGAAGTT pLKO_005 575 CDS 100% 4.950 3.465 N DAZAP1 n/a
10 TRCN0000158858 GAGAAGTCGTAGATTGTGTTA pLKO.1 289 CDS 100% 4.950 3.465 N DAZAP1 n/a
11 TRCN0000275262 GAGAAGTCGTAGATTGTGTTA pLKO_005 289 CDS 100% 4.950 3.465 N DAZAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018959.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02966 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02966 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000491423 CCGGTGATCCTGAAGAGTAGAGGC pLX_317 20.5% 100% 100% V5 n/a
Download CSV