Construct: ORF TRCN0000491423
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006344.2_s317c1
- Derived from:
- ccsbBroadEn_02966
- DNA Barcode:
- CCGGTGATCCTGAAGAGTAGAGGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DAZAP1 (26528)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491423
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 26528 | DAZAP1 | DAZ associated protein 1 | NM_018959.4 | 100% | 100% | |
| 2 | human | 26528 | DAZAP1 | DAZ associated protein 1 | NM_001352033.2 | 99.7% | 99.7% | 302_303insGCA |
| 3 | human | 26528 | DAZAP1 | DAZ associated protein 1 | NM_001352034.2 | 99.7% | 99.7% | 1047_1048insGCA |
| 4 | human | 26528 | DAZAP1 | DAZ associated protein 1 | XM_011527910.2 | 89.9% | 89.9% | 0_1ins123 |
| 5 | human | 26528 | DAZAP1 | DAZ associated protein 1 | NM_170711.3 | 88.2% | 84.9% | (many diffs) |
| 6 | human | 26528 | DAZAP1 | DAZ associated protein 1 | XM_011527904.2 | 73.3% | 71.8% | (many diffs) |
| 7 | human | 26528 | DAZAP1 | DAZ associated protein 1 | XM_011527905.2 | 73.1% | 71.6% | (many diffs) |
| 8 | human | 26528 | DAZAP1 | DAZ associated protein 1 | XM_011527906.2 | 73.1% | 71.6% | (many diffs) |
| 9 | human | 26528 | DAZAP1 | DAZ associated protein 1 | XM_011527907.2 | 72.9% | 71.4% | (many diffs) |
| 10 | human | 26528 | DAZAP1 | DAZ associated protein 1 | XM_011527908.2 | 64.9% | 61.2% | (many diffs) |
| 11 | human | 26528 | DAZAP1 | DAZ associated protein 1 | XM_011527909.3 | 64.9% | 61.2% | (many diffs) |
| 12 | human | 26528 | DAZAP1 | DAZ associated protein 1 | NM_001352035.2 | 57.4% | 55% | 0_1ins436;27_28ins83 |
| 13 | human | 26528 | DAZAP1 | DAZ associated protein 1 | XM_005259535.3 | 57.4% | 55% | 0_1ins436;27_28ins83 |
| 14 | human | 26528 | DAZAP1 | DAZ associated protein 1 | XM_005259536.4 | 57.2% | 54.8% | 0_1ins436;27_28ins83;528_529insGCA |
| 15 | human | 26528 | DAZAP1 | DAZ associated protein 1 | XM_017026582.2 | 31.4% | 26.2% | (many diffs) |
| 16 | mouse | 70248 | Dazap1 | DAZ associated protein 1 | XM_006514069.3 | 89.1% | 98.5% | (many diffs) |
| 17 | mouse | 70248 | Dazap1 | DAZ associated protein 1 | NM_001122604.1 | 88.8% | 98.2% | (many diffs) |
| 18 | mouse | 70248 | Dazap1 | DAZ associated protein 1 | NM_001122605.1 | 88.8% | 98.2% | (many diffs) |
| 19 | mouse | 70248 | Dazap1 | DAZ associated protein 1 | NM_133188.2 | 88.6% | 98% | (many diffs) |
| 20 | mouse | 70248 | Dazap1 | DAZ associated protein 1 | XM_006514070.4 | 87.3% | 96.8% | (many diffs) |
| 21 | mouse | 70248 | Dazap1 | DAZ associated protein 1 | XM_006514071.4 | 87% | 96.5% | (many diffs) |
| 22 | mouse | 70248 | Dazap1 | DAZ associated protein 1 | XM_030245258.1 | 87% | 96.5% | (many diffs) |
| 23 | mouse | 70248 | Dazap1 | DAZ associated protein 1 | XM_030245259.1 | 86.8% | 96.3% | (many diffs) |
| 24 | mouse | 70248 | Dazap1 | DAZ associated protein 1 | XM_006514072.4 | 58% | 64.1% | (many diffs) |
| 25 | mouse | 70248 | Dazap1 | DAZ associated protein 1 | XM_006514073.4 | 57.8% | 63.8% | (many diffs) |
| 26 | mouse | 70248 | Dazap1 | DAZ associated protein 1 | XM_006514074.4 | 50.6% | 54.5% | (many diffs) |
| 27 | mouse | 70248 | Dazap1 | DAZ associated protein 1 | XM_011243559.3 | 50.6% | 54.5% | (many diffs) |
| 28 | mouse | 70248 | Dazap1 | DAZ associated protein 1 | XM_030245260.1 | 50.4% | 54.2% | (many diffs) |
| 29 | mouse | 70248 | Dazap1 | DAZ associated protein 1 | XM_030245261.1 | 50.4% | 54.2% | (many diffs) |
| 30 | mouse | 70248 | Dazap1 | DAZ associated protein 1 | XM_030245262.1 | 50.4% | 54.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1287
- ORF length:
- 1221
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa caactcgggc gccgacgaga tcgggaagct cttcgtgggc ggtcttgact 121 ggagcacgac ccaagagact ctgcgcagct acttttccca atatggagaa gtcgtagatt 181 gtgttatcat gaaagataaa accaccaacc agtctcgagg ctttgggttt gtcaaattta 241 aagacccaaa ctgtgtgggg acggtgctgg ccagcagacc gcacacgcta gatggccgaa 301 acatcgaccc caagccatgc acaccccggg ggatgcagcc ggagagaaca cggccgaagg 361 aaggatggca gaaaggaccc aggagcgata acagtaaatc aaataagata tttgtcggtg 421 gaattcctca caattgtggt gagacagagc tcagggaata cttcaagaag ttcggagtgg 481 tcacggaggt agtcatgatc tatgacgccg agaagcagag gccccgaggt tttggattta 541 ttactttcga ggacgaacaa tcagtggacc aggctgtcaa catgcatttt cacgacatca 601 tgggcaaaaa agtggaagtt aaacgagctg agcctcggga cagcaagagc caagcgccgg 661 gacagccagg tgccagccag tgggggagcc gggttgtgcc caacgctgcc aatggctggg 721 caggccagcc cccgcccacg tggcagcaag gatatggccc gcaaggaatg tgggtgccgg 781 caggacaggc gattggtggc tatggaccgc cccctgcagg aagaggagcc cccccgccac 841 ccccaccgtt cacctcctac atcgtgtcca cccctcctgg aggctttccc cctccccagg 901 gcttccctca gggctacggt gccccgccac agttcagttt tggctacggg cctccacctc 961 caccgccaga tcagtttgcc cctccggggg ttcctcctcc accagccact cccggggcag 1021 cacctctggc tttcccaccg ccTCCGTCTC AGGCTGCCCC GGACATGAGC AAGCCCCCGA 1081 CAGCTCAGCC AGACTTCCCC TATGGTCAGT ATGCAGGTTA CGGGCAGGAC TTGAGTGGCT 1141 TCGGACAGGG CTTCTCAGAC CCCAGCCAGC AGCCTCCTTC CTACGGGGGT CCCTCCGTGC 1201 CAGGGTCGGG GGGCCCCCCC GCCGGCGGCA GCGGCTTTGG ACGAGGGCAG AACCACAACG 1261 TGCAAGGGTT CCACCCCTAC CGACGCTACC CAACTTTCTT GTACAAAGTG GTTGATATCG 1321 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1381 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GACCGGTGAT 1441 CCTGAAGAGT AGAGGCACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1501 aagatt