Transcript: Human NM_018994.3

Homo sapiens F-box protein 42 (FBXO42), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
FBXO42 (54455)
Length:
6227
CDS:
244..2397

Additional Resources:

NCBI RefSeq record:
NM_018994.3
NBCI Gene record:
FBXO42 (54455)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018994.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138875 GCTTGGTTGTTGCACATGCAT pLKO.1 1177 CDS 100% 3.000 4.200 N FBXO42 n/a
2 TRCN0000138637 CGCTTCCAGTAGTAATCCCAT pLKO.1 1767 CDS 100% 2.640 3.696 N FBXO42 n/a
3 TRCN0000137851 GAGTATGAACTGCAAGCCCAT pLKO.1 2154 CDS 100% 2.160 3.024 N FBXO42 n/a
4 TRCN0000277616 CAAACAGTGGTATCGACTTAT pLKO_005 468 CDS 100% 13.200 10.560 N FBXO42 n/a
5 TRCN0000277618 CACTCCAGGCTGGGATCAAAT pLKO_005 2528 3UTR 100% 13.200 9.240 N FBXO42 n/a
6 TRCN0000277679 CTCGCACAGTGCATGCTATTA pLKO_005 603 CDS 100% 13.200 9.240 N FBXO42 n/a
7 TRCN0000285999 TAGATGATGCAACTATCTTAA pLKO_005 1115 CDS 100% 13.200 9.240 N FBXO42 n/a
8 TRCN0000133892 CCAGAGAGATTCTTTGATGAA pLKO.1 850 CDS 100% 4.950 3.465 N FBXO42 n/a
9 TRCN0000138636 CCTGAAGGATACGACCTGAAA pLKO.1 1654 CDS 100% 4.950 3.465 N FBXO42 n/a
10 TRCN0000136615 GCAACTATCTTAATCCTCGGA pLKO.1 1123 CDS 100% 0.660 0.462 N FBXO42 n/a
11 TRCN0000134822 CCATCAGTGTTATCATGGTTT pLKO.1 501 CDS 100% 4.950 2.970 N FBXO42 n/a
12 TRCN0000277617 CCATCAGTGTTATCATGGTTT pLKO_005 501 CDS 100% 4.950 2.970 N FBXO42 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018994.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03416 pDONR223 100% 99.9% 100% None 15G>A n/a
2 ccsbBroad304_03416 pLX_304 0% 99.9% 100% V5 15G>A n/a
3 TRCN0000474599 AACAGTTTTAACCTAGCCTGCTGC pLX_317 19.1% 99.9% 100% V5 15G>A n/a
Download CSV