Transcript: Human NM_019059.4

Homo sapiens translocase of outer mitochondrial membrane 7 (TOMM7), mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
TOMM7 (54543)
Length:
776
CDS:
71..238

Additional Resources:

NCBI RefSeq record:
NM_019059.4
NBCI Gene record:
TOMM7 (54543)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_019059.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161961 GAATGCCTGAACCAACTGTTT pLKO.1 198 CDS 100% 4.950 6.930 N TOMM7 n/a
2 TRCN0000343314 GAATGCCTGAACCAACTGTTT pLKO_005 198 CDS 100% 4.950 6.930 N TOMM7 n/a
3 TRCN0000158618 CTTTATCCCTCTTGTGATTTA pLKO.1 148 CDS 100% 13.200 9.240 N TOMM7 n/a
4 TRCN0000159256 GCTTTATCCCTCTTGTGATTT pLKO.1 147 CDS 100% 13.200 9.240 N TOMM7 n/a
5 TRCN0000343313 GCTTTATCCCTCTTGTGATTT pLKO_005 147 CDS 100% 13.200 9.240 N TOMM7 n/a
6 TRCN0000158967 GAATTGAACATGCTAGGATTA pLKO.1 454 3UTR 100% 10.800 7.560 N TOMM7 n/a
7 TRCN0000162944 GAGACTACAGCAGCTCTTCAA pLKO.1 100 CDS 100% 4.950 3.465 N TOMM7 n/a
8 TRCN0000163872 CTCGGATAAGAGATGGGACAT pLKO.1 303 3UTR 100% 4.050 2.835 N TOMM7 n/a
9 TRCN0000352897 CTCGGATAAGAGATGGGACAT pLKO_005 303 3UTR 100% 4.050 2.835 N TOMM7 n/a
10 TRCN0000164552 CCTCTTGTGATTTACCTGGGA pLKO.1 155 CDS 100% 0.660 0.462 N TOMM7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019059.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03434 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03434 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474745 CTGACGCGCGGGAAAGGTCGAAAC pLX_317 100% 100% 100% V5 n/a
Download CSV