Transcript: Human NM_019098.4

Homo sapiens cyclic nucleotide gated channel subunit beta 3 (CNGB3), mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
CNGB3 (54714)
Length:
4354
CDS:
49..2478

Additional Resources:

NCBI RefSeq record:
NM_019098.4
NBCI Gene record:
CNGB3 (54714)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_019098.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044228 CCCATATCAAACCGCAGACAA pLKO.1 774 CDS 100% 4.950 6.930 N CNGB3 n/a
2 TRCN0000425766 GGCTAATTGTTCTAGGTTTAT pLKO_005 2874 3UTR 100% 13.200 10.560 N CNGB3 n/a
3 TRCN0000429267 TATTGGGCAGTTCGAACTTTA pLKO_005 1243 CDS 100% 13.200 10.560 N CNGB3 n/a
4 TRCN0000432468 AGAGTACTTAAAGCGAATTAA pLKO_005 642 CDS 100% 15.000 10.500 N CNGB3 n/a
5 TRCN0000044230 CCAAGAAATTCTAGTGCATTA pLKO.1 1920 CDS 100% 10.800 7.560 N CNGB3 n/a
6 TRCN0000044229 CCTGGTGACTTTGTCTGCAAA pLKO.1 1687 CDS 100% 4.950 3.465 N CNGB3 n/a
7 TRCN0000044232 GATTCAAATGAGCTAAGGAAA pLKO.1 904 CDS 100% 4.950 3.465 N CNGB3 n/a
8 TRCN0000044231 CCGAAAGAAGAGACACCCAAA pLKO.1 2050 CDS 100% 4.050 2.835 N CNGB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019098.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.