Transcript: Human NM_019117.5

Homo sapiens kelch like family member 4 (KLHL4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
KLHL4 (56062)
Length:
5765
CDS:
93..2249

Additional Resources:

NCBI RefSeq record:
NM_019117.5
NBCI Gene record:
KLHL4 (56062)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_019117.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062009 CCACATACAATGGATTCTTAT pLKO.1 1930 CDS 100% 13.200 18.480 N KLHL4 n/a
2 TRCN0000062010 CGCAGAGCAAACTCTTCGTAA pLKO.1 584 CDS 100% 4.950 6.930 N KLHL4 n/a
3 TRCN0000062008 GCCATTATTCTCCTATTCAAA pLKO.1 2717 3UTR 100% 5.625 3.938 N KLHL4 n/a
4 TRCN0000062011 CCTGCCTCAAATCAATGGAAT pLKO.1 1837 CDS 100% 4.950 3.465 N KLHL4 n/a
5 TRCN0000062012 GCCTGAGAGAAGATCCATGAT pLKO.1 1319 CDS 100% 4.950 3.465 N KLHL4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019117.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14215 pDONR223 100% 99.9% 99.4% None 1359C>T;2144_2145insG n/a
2 ccsbBroad304_14215 pLX_304 0% 99.9% 99.4% V5 (not translated due to frame shift) 1359C>T;2144_2145insG n/a
3 TRCN0000478041 CATTATCGTAACAATCCTTGAAGT pLX_317 20.7% 99.9% 99.4% V5 (not translated due to prior stop codon) 1359C>T;2144_2145insG n/a
Download CSV