Transcript: Mouse NM_019425.2

Mus musculus glucosamine-phosphate N-acetyltransferase 1 (Gnpnat1), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Gnpnat1 (54342)
Length:
2536
CDS:
64..618

Additional Resources:

NCBI RefSeq record:
NM_019425.2
NBCI Gene record:
Gnpnat1 (54342)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019425.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114595 CGGAACAGTTCATGAAATCTT pLKO.1 266 CDS 100% 5.625 7.875 N Gnpnat1 n/a
2 TRCN0000324410 CGGAACAGTTCATGAAATCTT pLKO_005 266 CDS 100% 5.625 7.875 N Gnpnat1 n/a
3 TRCN0000114593 GAGTCAGAATACAGCTATATT pLKO.1 120 CDS 100% 15.000 10.500 N Gnpnat1 n/a
4 TRCN0000324411 GAGTCAGAATACAGCTATATT pLKO_005 120 CDS 100% 15.000 10.500 N Gnpnat1 n/a
5 TRCN0000034620 CCCTTGAATGTCTACCACAAA pLKO.1 524 CDS 100% 4.950 3.465 N GNPNAT1 n/a
6 TRCN0000114594 GAGTAGAAGATGTCGTCGTTA pLKO.1 416 CDS 100% 4.950 3.465 N Gnpnat1 n/a
7 TRCN0000324342 GAGTAGAAGATGTCGTCGTTA pLKO_005 416 CDS 100% 4.950 3.465 N Gnpnat1 n/a
8 TRCN0000114592 GCAACTCTGATAATAGAACAT pLKO.1 364 CDS 100% 4.950 3.465 N Gnpnat1 n/a
9 TRCN0000324343 GCAACTCTGATAATAGAACAT pLKO_005 364 CDS 100% 4.950 3.465 N Gnpnat1 n/a
10 TRCN0000114591 CCATTGACATTTGAAGCCTTT pLKO.1 1257 3UTR 100% 4.050 2.835 N Gnpnat1 n/a
11 TRCN0000324409 CCATTGACATTTGAAGCCTTT pLKO_005 1257 3UTR 100% 4.050 2.835 N Gnpnat1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019425.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03977 pDONR223 100% 91.6% 98.3% None (many diffs) n/a
2 ccsbBroad304_03977 pLX_304 0% 91.6% 98.3% V5 (many diffs) n/a
3 TRCN0000474499 TGAGGTGAACGATCACGCCTAATT pLX_317 91.9% 91.6% 98.3% V5 (many diffs) n/a
Download CSV