Transcript: Mouse NM_019466.4

Mus musculus regulator of calcineurin 1 (Rcan1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Rcan1 (54720)
Length:
2195
CDS:
97..693

Additional Resources:

NCBI RefSeq record:
NM_019466.4
NBCI Gene record:
Rcan1 (54720)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019466.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105818 GCTTCAAACGTGTCCGGATAA pLKO.1 245 CDS 100% 10.800 15.120 N Rcan1 n/a
2 TRCN0000105816 CCGTCATAAATTACGATCTTT pLKO.1 470 CDS 100% 5.625 7.875 N Rcan1 n/a
3 TRCN0000105819 CTCAGACTTTACACATAGGAA pLKO.1 353 CDS 100% 3.000 4.200 N Rcan1 n/a
4 TRCN0000105815 CCCAAGTAGAACTTAGCCTAA pLKO.1 1409 3UTR 100% 4.050 3.240 N Rcan1 n/a
5 TRCN0000105817 CCTGATTGCTTGTGTGGCAAA pLKO.1 132 CDS 100% 4.050 2.835 N Rcan1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019466.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10788 pDONR223 100% 76.8% 86.8% None (many diffs) n/a
2 ccsbBroad304_10788 pLX_304 0% 76.8% 86.8% V5 (many diffs) n/a
3 TRCN0000474237 AATGCATTGCCCTCAATCATTTTC pLX_317 89.8% 76.8% 86.8% V5 (many diffs) n/a
Download CSV