Transcript: Mouse NM_019477.3

Mus musculus acyl-CoA synthetase long-chain family member 4 (Acsl4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Acsl4 (50790)
Length:
4990
CDS:
294..2306

Additional Resources:

NCBI RefSeq record:
NM_019477.3
NBCI Gene record:
Acsl4 (50790)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019477.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011984 GCCATGAAATTGGAGCGATTT pLKO.1 2145 CDS 100% 10.800 15.120 N Acsl4 n/a
2 TRCN0000278172 GCCATGAAATTGGAGCGATTT pLKO_005 2145 CDS 100% 10.800 15.120 N Acsl4 n/a
3 TRCN0000011987 GCAGAAGATTATTGTGTTGAT pLKO.1 1782 CDS 100% 4.950 3.960 N Acsl4 n/a
4 TRCN0000278173 GCAGAAGATTATTGTGTTGAT pLKO_005 1782 CDS 100% 4.950 3.960 N Acsl4 n/a
5 TRCN0000011986 GCAGAGTGAATAACTTTGGAA pLKO.1 568 CDS 100% 3.000 2.400 N Acsl4 n/a
6 TRCN0000278174 GCAGAGTGAATAACTTTGGAA pLKO_005 568 CDS 100% 3.000 2.400 N Acsl4 n/a
7 TRCN0000011983 CCTAGTTCAGAAGTTTCTATA pLKO.1 2670 3UTR 100% 13.200 9.240 N Acsl4 n/a
8 TRCN0000297390 CCTAGTTCAGAAGTTTCTATA pLKO_005 2670 3UTR 100% 13.200 9.240 N Acsl4 n/a
9 TRCN0000045538 CCGGAAATCATGGATAGAATT pLKO.1 1293 CDS 100% 0.000 0.000 N ACSL4 n/a
10 TRCN0000011985 GCAAGGTTCAAGAGATGAATT pLKO.1 1330 CDS 100% 0.000 0.000 N Acsl4 n/a
11 TRCN0000297179 GCAAGGTTCAAGAGATGAATT pLKO_005 1330 CDS 100% 0.000 0.000 N Acsl4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019477.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06194 pDONR223 100% 92.2% 96.7% None (many diffs) n/a
Download CSV