Transcript: Mouse NM_019500.4

Mus musculus claudin 14 (Cldn14), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Cldn14 (56173)
Length:
1475
CDS:
533..1252

Additional Resources:

NCBI RefSeq record:
NM_019500.4
NBCI Gene record:
Cldn14 (56173)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019500.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091020 ACAGGCTGAATGACTACGTGT pLKO.1 1230 CDS 100% 2.640 3.696 N Cldn14 n/a
2 TRCN0000091022 CCGGAGCTACCACCACGGCTA pLKO.1 1131 CDS 100% 0.000 0.000 N Cldn14 n/a
3 TRCN0000091021 CCCAGTGGCATGAAGTTTGAA pLKO.1 989 CDS 100% 5.625 3.938 N Cldn14 n/a
4 TRCN0000091019 ACGAATGACGTGGTGCAGAAT pLKO.1 950 CDS 100% 4.950 3.465 N Cldn14 n/a
5 TRCN0000091018 GACCAATGATGGATGTGGGAA pLKO.1 1295 3UTR 100% 2.640 1.848 N Cldn14 n/a
6 TRCN0000082916 ACACCCGCCAAGACCACCTTT pLKO.1 863 CDS 100% 1.650 1.155 N CLDN14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019500.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02795 pDONR223 100% 86.5% 93.3% None (many diffs) n/a
2 ccsbBroad304_02795 pLX_304 0% 86.5% 93.3% V5 (many diffs) n/a
3 TRCN0000475201 CGGTCCGCGGCCATCACATTACTA pLX_317 59.5% 86.5% 93.3% V5 (many diffs) n/a
Download CSV