Transcript: Mouse NM_019516.3

Mus musculus lectin, galactose binding, soluble 12 (Lgals12), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Lgals12 (56072)
Length:
2755
CDS:
447..1391

Additional Resources:

NCBI RefSeq record:
NM_019516.3
NBCI Gene record:
Lgals12 (56072)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019516.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419326 GGCTGAAGTTGGCACTCAATG pLKO_005 1270 CDS 100% 10.800 15.120 N Lgals12 n/a
2 TRCN0000066985 CGGGTAGATACCCTTGACATA pLKO.1 873 CDS 100% 4.950 6.930 N Lgals12 n/a
3 TRCN0000066987 CGGTGATTCCTTATGGCACAA pLKO.1 514 CDS 100% 4.050 5.670 N Lgals12 n/a
4 TRCN0000417116 ATCTATCTTCCACATTCAAAT pLKO_005 1644 3UTR 100% 13.200 10.560 N Lgals12 n/a
5 TRCN0000441355 TTCGAGGACTGGTCTTGAAAG pLKO_005 1063 CDS 100% 10.800 7.560 N Lgals12 n/a
6 TRCN0000066984 CCCTCGATTCTACACTGTCAA pLKO.1 671 CDS 100% 4.950 3.465 N Lgals12 n/a
7 TRCN0000066983 GCCAGGGATTATTCAGTCTAT pLKO.1 1986 3UTR 100% 4.950 3.465 N Lgals12 n/a
8 TRCN0000066986 GCAGAGAGTATCCAGTTGGAT pLKO.1 955 CDS 100% 3.000 2.100 N Lgals12 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1539 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019516.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04477 pDONR223 100% 79.5% 75.8% None (many diffs) n/a
2 ccsbBroad304_04477 pLX_304 0% 79.5% 75.8% V5 (many diffs) n/a
3 TRCN0000471699 CCCGAAATCCCCCGATGCCCATTT pLX_317 36.4% 79.5% 75.8% V5 (many diffs) n/a
Download CSV