Transcript: Mouse NM_019553.2

Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 (Ddx21), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Ddx21 (56200)
Length:
4763
CDS:
85..2640

Additional Resources:

NCBI RefSeq record:
NM_019553.2
NBCI Gene record:
Ddx21 (56200)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019553.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313706 TGTGGAGCACCTGGCGATTAA pLKO_005 1530 CDS 100% 13.200 18.480 N Ddx21 n/a
2 TRCN0000103972 CCCAACCTTCTGAACCGAAAT pLKO.1 761 CDS 100% 10.800 8.640 N Ddx21 n/a
3 TRCN0000317294 CCCAACCTTCTGAACCGAAAT pLKO_005 761 CDS 100% 10.800 8.640 N Ddx21 n/a
4 TRCN0000103971 CGCACGATCATCTTCTGTGAA pLKO.1 1618 CDS 100% 4.950 3.960 N Ddx21 n/a
5 TRCN0000103974 GCACGATCATCTTCTGTGAAA pLKO.1 1619 CDS 100% 4.950 3.465 N Ddx21 n/a
6 TRCN0000317224 GCACGATCATCTTCTGTGAAA pLKO_005 1619 CDS 100% 4.950 3.465 N Ddx21 n/a
7 TRCN0000103973 GCCATCCCTTTAATTGAGAAA pLKO.1 1021 CDS 100% 4.950 3.465 N Ddx21 n/a
8 TRCN0000317295 GCCATCCCTTTAATTGAGAAA pLKO_005 1021 CDS 100% 4.950 3.465 N Ddx21 n/a
9 TRCN0000313705 TACACACGCCCTGCAACTAAA pLKO_005 2978 3UTR 100% 13.200 7.920 N Ddx21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019553.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15661 pDONR223 0% 70.6% 71.9% None (many diffs) n/a
2 ccsbBroad304_15661 pLX_304 0% 70.6% 71.9% V5 (many diffs) n/a
3 TRCN0000481512 GCCGAGAACACCGGAACCAAATAT pLX_317 14.4% 70.6% 71.9% V5 (many diffs) n/a
Download CSV