Transcript: Mouse NM_019573.3

Mus musculus WW domain-containing oxidoreductase (Wwox), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Wwox (80707)
Length:
2251
CDS:
121..1365

Additional Resources:

NCBI RefSeq record:
NM_019573.3
NBCI Gene record:
Wwox (80707)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019573.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042115 GCTGGCTTATAACAGATCTAA pLKO.1 990 CDS 100% 5.625 4.500 N Wwox n/a
2 TRCN0000042113 CCCACAGATTTACAGATATTA pLKO.1 905 CDS 100% 15.000 10.500 N Wwox n/a
3 TRCN0000042116 GAAGCATTCAAGGCCAAGAAT pLKO.1 703 CDS 100% 5.625 3.938 N Wwox n/a
4 TRCN0000042114 CGGAGGGATGTATTTCAACAA pLKO.1 1233 CDS 100% 4.950 3.465 N Wwox n/a
5 TRCN0000042117 CGCCAATCACACTGAGGAGAA pLKO.1 222 CDS 100% 4.050 2.835 N Wwox n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019573.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12014 pDONR223 100% 49.1% 53.6% None (many diffs) n/a
2 ccsbBroad304_12014 pLX_304 0% 49.1% 53.6% V5 (many diffs) n/a
3 TRCN0000477500 GTGAAATTAGTTGTGCGCCCTTTT pLX_317 57.7% 49.1% 53.6% V5 (many diffs) n/a
Download CSV