Transcript: Human NM_019605.5

Homo sapiens SERTA domain containing 4 (SERTAD4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
SERTAD4 (56256)
Length:
5222
CDS:
234..1304

Additional Resources:

NCBI RefSeq record:
NM_019605.5
NBCI Gene record:
SERTAD4 (56256)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_019605.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421469 ACGATTGACTTAATGCTTAAA pLKO_005 1518 3UTR 100% 13.200 18.480 N SERTAD4 n/a
2 TRCN0000412619 CAGTTAATTAGGGAGTTATTT pLKO_005 1662 3UTR 100% 15.000 12.000 N SERTAD4 n/a
3 TRCN0000426539 GGGAATTTCAAATCCTATAAC pLKO_005 422 CDS 100% 13.200 10.560 N SERTAD4 n/a
4 TRCN0000116085 CCTCCGAAGATCTGTCCTTAT pLKO.1 608 CDS 100% 10.800 8.640 N SERTAD4 n/a
5 TRCN0000247970 TTTGAGTGCAAAGGCCAATTT pLKO_005 1155 CDS 100% 13.200 9.240 N Sertad4 n/a
6 TRCN0000116083 GCATCTATTTACAAGAGTGAT pLKO.1 984 CDS 100% 4.950 3.465 N SERTAD4 n/a
7 TRCN0000116086 CTGTCAATGCTAATGTTGGAA pLKO.1 847 CDS 100% 3.000 2.100 N SERTAD4 n/a
8 TRCN0000116084 CCACATCCTTTATATGTCCTT pLKO.1 551 CDS 100% 2.640 1.848 N SERTAD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019605.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03714 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03714 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480559 CGGATCATAGTTGCTGAAGCTAAG pLX_317 36.5% 100% 100% V5 n/a
Download CSV