Transcript: Human NM_019618.4

Homo sapiens interleukin 36 gamma (IL36G), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
IL36G (56300)
Length:
1211
CDS:
93..602

Additional Resources:

NCBI RefSeq record:
NM_019618.4
NBCI Gene record:
IL36G (56300)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_019618.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058178 CGTCTATCAATCAATGTGTAA pLKO.1 134 CDS 100% 4.950 6.930 N IL36G n/a
2 TRCN0000058182 GTAAACCTATTACTGGGACTA pLKO.1 151 CDS 100% 4.050 5.670 N IL36G n/a
3 TRCN0000372571 TGATATCATCCAGTCTTTATA pLKO_005 1013 3UTR 100% 15.000 12.000 N IL36G n/a
4 TRCN0000058181 GCTGTTATCACATGCAAGTAT pLKO.1 261 CDS 100% 5.625 4.500 N IL36G n/a
5 TRCN0000372572 CAGGAGAGCTGGGTGGTATAA pLKO_005 797 3UTR 100% 13.200 9.240 N IL36G n/a
6 TRCN0000372624 GGGAATCCAGAATCCAGAAAT pLKO_005 323 CDS 100% 13.200 9.240 N IL36G n/a
7 TRCN0000058180 GCAGAAGATCATGGATCTGTA pLKO.1 395 CDS 100% 4.950 3.465 N IL36G n/a
8 TRCN0000058179 CCCATCATTCTGACTTCAGAA pLKO.1 534 CDS 100% 0.495 0.347 N IL36G n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019618.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03718 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03718 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474741 TACACGTCCATCCGCTTCTACACC pLX_317 95.2% 100% 100% V5 n/a
Download CSV