Transcript: Mouse NM_019675.3

Mus musculus stathmin-like 4 (Stmn4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Stmn4 (56471)
Length:
1328
CDS:
196..765

Additional Resources:

NCBI RefSeq record:
NM_019675.3
NBCI Gene record:
Stmn4 (56471)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019675.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163179 GACCAGTGAAGCCATCCTATT pLKO.1 930 3UTR 100% 10.800 7.560 N STMN4 n/a
2 TRCN0000115530 CATCTCTGATATGGAAGTCAT pLKO.1 333 CDS 100% 4.950 3.465 N Stmn4 n/a
3 TRCN0000115529 CCCATCATTAGAAGAGATTCA pLKO.1 459 CDS 100% 4.950 3.465 N Stmn4 n/a
4 TRCN0000115527 CCTGAATAAATCATCCTACAA pLKO.1 276 CDS 100% 4.950 3.465 N Stmn4 n/a
5 TRCN0000115526 CGAGTGGAGAGAAGATGAGAA pLKO.1 1114 3UTR 100% 4.950 3.465 N Stmn4 n/a
6 TRCN0000115528 GACCCATCATTAGAAGAGATT pLKO.1 457 CDS 100% 4.950 3.465 N Stmn4 n/a
7 TRCN0000160910 GAAGTCATCGAGCTGAACAAA pLKO.1 346 CDS 100% 5.625 3.938 N STMN4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019675.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04236 pDONR223 100% 77.3% 87% None (many diffs) n/a
2 ccsbBroad304_04236 pLX_304 0% 77.3% 87% V5 (many diffs) n/a
3 TRCN0000472188 TTGCTGTTCCCCCGCACCTGTGTG pLX_317 58.6% 77.3% 87% V5 (many diffs) n/a
Download CSV