Transcript: Mouse NM_019704.2

Mus musculus transmembrane protein 115 (Tmem115), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tmem115 (56395)
Length:
2177
CDS:
535..1587

Additional Resources:

NCBI RefSeq record:
NM_019704.2
NBCI Gene record:
Tmem115 (56395)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019704.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055241 CTTGGTTTACCTGTTCACTAT pLKO.1 912 CDS 100% 4.950 6.930 N Tmem115 n/a
2 TRCN0000055238 CCTCCTGGTGAAAGTAAAGAT pLKO.1 1269 CDS 100% 5.625 3.938 N Tmem115 n/a
3 TRCN0000055242 GCAGAAGGCAACTAGCCCTAA pLKO.1 1379 CDS 100% 4.050 2.835 N Tmem115 n/a
4 TRCN0000055240 GCTGCTATCCAGTTGGGTGTA pLKO.1 1125 CDS 100% 4.050 2.835 N Tmem115 n/a
5 TRCN0000055239 GTACTGTTTCTCTACCTGCTT pLKO.1 622 CDS 100% 2.640 1.848 N Tmem115 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019704.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02611 pDONR223 100% 87.9% 94% None (many diffs) n/a
2 ccsbBroad304_02611 pLX_304 0% 87.9% 94% V5 (many diffs) n/a
3 TRCN0000468687 ATTCATAACATCGCCTGACCAGTC pLX_317 26.7% 87.9% 94% V5 (many diffs) n/a
Download CSV