Transcript: Mouse NM_019757.1

Mus musculus fizzy/cell division cycle 20 related 1 (Drosophila) (Fzr1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Fzr1 (56371)
Length:
2258
CDS:
143..1624

Additional Resources:

NCBI RefSeq record:
NM_019757.1
NBCI Gene record:
Fzr1 (56371)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019757.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273792 ATGATCCTACAGCGGGATATC pLKO_005 1016 CDS 100% 10.800 15.120 N Fzr1 n/a
2 TRCN0000027682 GATCTCTAAGATTCCCTTCAA pLKO.1 652 CDS 100% 4.950 3.960 N Fzr1 n/a
3 TRCN0000273739 GATCTCTAAGATTCCCTTCAA pLKO_005 652 CDS 100% 4.950 3.960 N Fzr1 n/a
4 TRCN0000027734 CTCACCCTGTGACACTCTTAA pLKO.1 1990 3UTR 100% 13.200 9.240 N Fzr1 n/a
5 TRCN0000027681 CGGCAGATCATCATCCAGAAT pLKO.1 173 CDS 100% 4.950 3.465 N Fzr1 n/a
6 TRCN0000027684 CGTGAACTTCCACAGGATCAA pLKO.1 316 CDS 100% 4.950 3.465 N Fzr1 n/a
7 TRCN0000273793 CGTGAACTTCCACAGGATCAA pLKO_005 316 CDS 100% 4.950 3.465 N Fzr1 n/a
8 TRCN0000027712 GTGTGGAACCACTCTAGTCTA pLKO.1 1157 CDS 100% 4.950 3.465 N Fzr1 n/a
9 TRCN0000273791 GTGTGGAACCACTCTAGTCTA pLKO_005 1157 CDS 100% 4.950 3.465 N Fzr1 n/a
10 TRCN0000273741 TGGACACTTGCCACCTGTTAC pLKO_005 1813 3UTR 100% 10.800 6.480 N Fzr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019757.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03287 pDONR223 100% 88% 98.3% None (many diffs) n/a
2 ccsbBroad304_03287 pLX_304 0% 88% 98.3% V5 (many diffs) n/a
Download CSV