Transcript: Mouse NM_019758.3

Mus musculus mitochondrial carrier 2 (Mtch2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Mtch2 (56428)
Length:
2596
CDS:
145..1056

Additional Resources:

NCBI RefSeq record:
NM_019758.3
NBCI Gene record:
Mtch2 (56428)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019758.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114238 CCCAATATACACTTCTTGGAT pLKO.1 921 CDS 100% 3.000 4.200 N Mtch2 n/a
2 TRCN0000288203 CCCAATATACACTTCTTGGAT pLKO_005 921 CDS 100% 3.000 4.200 N Mtch2 n/a
3 TRCN0000059393 CCTCCAACAATAGGACGAAAT pLKO.1 250 CDS 100% 10.800 8.640 N MTCH2 n/a
4 TRCN0000114240 TCCTCCAACAATAGGACGAAA pLKO.1 249 CDS 100% 4.950 3.960 N Mtch2 n/a
5 TRCN0000114236 CCCAATAAGAAGCAGCTAATT pLKO.1 1385 3UTR 100% 13.200 9.240 N Mtch2 n/a
6 TRCN0000295557 GCATACCATGTGGGAGTTTAT pLKO_005 1430 3UTR 100% 13.200 9.240 N Mtch2 n/a
7 TRCN0000295556 AGCCGCTCATGTACGTGAAAG pLKO_005 200 CDS 100% 10.800 7.560 N Mtch2 n/a
8 TRCN0000114237 GCCTATCTCATCAATACCTAT pLKO.1 742 CDS 100% 4.950 3.465 N Mtch2 n/a
9 TRCN0000288268 GCCTATCTCATCAATACCTAT pLKO_005 742 CDS 100% 4.950 3.465 N Mtch2 n/a
10 TRCN0000114239 GCTGCTACCCTCATTACACAT pLKO.1 541 CDS 100% 4.950 3.465 N Mtch2 n/a
11 TRCN0000288267 GCTGCTACCCTCATTACACAT pLKO_005 541 CDS 100% 4.950 3.465 N Mtch2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019758.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02842 pDONR223 100% 91% 93.7% None (many diffs) n/a
2 ccsbBroad304_02842 pLX_304 0% 91% 93.7% V5 (many diffs) n/a
3 TRCN0000479897 AATCAAGAAGGGCGTCCGCATTCG pLX_317 39.1% 91% 93.7% V5 (many diffs) n/a
Download CSV