Transcript: Mouse NM_019761.6

Mus musculus NTF2-related export protein 1 (Nxt1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Nxt1 (56488)
Length:
969
CDS:
281..703

Additional Resources:

NCBI RefSeq record:
NM_019761.6
NBCI Gene record:
Nxt1 (56488)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019761.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124511 CAATGTCTATTACACGACTAT pLKO.1 343 CDS 100% 4.950 3.960 N Nxt1 n/a
2 TRCN0000146370 CTGTTTCAGGACAAGAATCCT pLKO.1 432 CDS 100% 3.000 2.400 N NXT1 n/a
3 TRCN0000124509 GCAGAGAAATGCCAGTCTCAA pLKO.1 742 3UTR 100% 4.950 3.465 N Nxt1 n/a
4 TRCN0000124510 CCACTTTAGTATGGAATGGAA pLKO.1 408 CDS 100% 3.000 2.100 N Nxt1 n/a
5 TRCN0000124513 GAGTTCCAAATCAGCGTGGTA pLKO.1 485 CDS 100% 2.640 1.848 N Nxt1 n/a
6 TRCN0000147131 CAAGAATCCTTGAGTGAGTTT pLKO.1 443 CDS 100% 4.950 2.970 N NXT1 n/a
7 TRCN0000275332 CAAGAATCCTTGAGTGAGTTT pLKO_005 443 CDS 100% 4.950 2.970 N NXT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019761.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03081 pDONR223 100% 91.4% 98.5% None (many diffs) n/a
2 ccsbBroad304_03081 pLX_304 0% 91.4% 98.5% V5 (many diffs) n/a
3 TRCN0000478751 GCCATCTCTTGCTCGCTAACCGCA pLX_317 100% 91.4% 98.5% V5 (many diffs) n/a
Download CSV