Transcript: Mouse NM_019770.2

Mus musculus transmembrane p24 trafficking protein 2 (Tmed2), mRNA.

Source:
NCBI, updated 2019-02-17
Taxon:
Mus musculus (mouse)
Gene:
Tmed2 (56334)
Length:
2029
CDS:
72..677

Additional Resources:

NCBI RefSeq record:
NM_019770.2
NBCI Gene record:
Tmed2 (56334)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019770.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113135 GCCAATAACTTAGCCGTTCTT pLKO.1 1275 3UTR 100% 4.950 3.465 N Tmed2 n/a
2 TRCN0000113139 GTCCACTATGACTCCAAAGAT pLKO.1 365 CDS 100% 5.625 2.813 Y Tmed2 n/a
3 TRCN0000113138 GAGCCATCAATGACAACACAA pLKO.1 547 CDS 100% 4.950 2.475 Y Tmed2 n/a
4 TRCN0000113137 GCTCATCAGAACAAGCTAGAA pLKO.1 444 CDS 100% 4.950 2.475 Y Tmed2 n/a
5 TRCN0000113136 TGGAGATCACAGGACCAGATA pLKO.1 247 CDS 100% 4.950 2.475 Y Tmed2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019770.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07715 pDONR223 100% 91.5% 99% None (many diffs) n/a
2 ccsbBroad304_07715 pLX_304 0% 91.5% 99% V5 (many diffs) n/a
3 TRCN0000468252 CATCGCAGTGGCCGCTCCATTTTC pLX_317 59.2% 91.5% 99% V5 (many diffs) n/a
Download CSV