Transcript: Mouse NM_019790.4

Mus musculus transmembrane protein with EGF-like and two follistatin-like domains 2 (Tmeff2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Tmeff2 (56363)
Length:
3339
CDS:
426..1550

Additional Resources:

NCBI RefSeq record:
NM_019790.4
NBCI Gene record:
Tmeff2 (56363)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019790.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080140 CCCAGAACATTATAATGGTTT pLKO.1 1220 CDS 100% 4.950 6.930 N Tmeff2 n/a
2 TRCN0000080141 CCGGTTACGATGACAGAGAAA pLKO.1 595 CDS 100% 4.950 6.930 N Tmeff2 n/a
3 TRCN0000080142 CGTCTGTCAGTTCAAGTGTAA pLKO.1 692 CDS 100% 4.950 3.960 N Tmeff2 n/a
4 TRCN0000373776 ATGCAGAGAATGCTAACAAAT pLKO_005 1165 CDS 100% 13.200 9.240 N TMEFF2 n/a
5 TRCN0000080139 CGGTTCCAGTACGTCTTGATT pLKO.1 1371 CDS 100% 5.625 3.938 N Tmeff2 n/a
6 TRCN0000080138 CCTCCTTTGTTAGAAACCAAA pLKO.1 2840 3UTR 100% 4.950 3.465 N Tmeff2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019790.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02827 pDONR223 100% 93.4% 98.9% None (many diffs) n/a
Download CSV