Transcript: Mouse NM_019815.3

Mus musculus claudin 18 (Cldn18), transcript variant A1.1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Mus musculus (mouse)
Gene:
Cldn18 (56492)
Length:
2842
CDS:
116..910

Additional Resources:

NCBI RefSeq record:
NM_019815.3
NBCI Gene record:
Cldn18 (56492)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019815.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091333 CCAGGTTAATACGCAGAGTTT pLKO.1 2369 3UTR 100% 4.950 6.930 N Cldn18 n/a
2 TRCN0000091336 CTTGTTCATCATCTCCGGCAT pLKO.1 484 CDS 100% 2.160 3.024 N Cldn18 n/a
3 TRCN0000091337 CGCCCTGAAGTGCATTCGCAT pLKO.1 412 CDS 100% 0.880 1.232 N Cldn18 n/a
4 TRCN0000091335 CTGATGATCGTGGGCATTGTT pLKO.1 359 CDS 100% 5.625 3.938 N Cldn18 n/a
5 TRCN0000116741 CTGGATGTCCACAGCTAACAT pLKO.1 556 CDS 100% 5.625 3.938 N CLDN18 n/a
6 TRCN0000091334 GCCCGCACAGAAGACGATGAA pLKO.1 857 CDS 100% 1.650 1.155 N Cldn18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019815.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03245 pDONR223 100% 86.3% 87.8% None (many diffs) n/a
2 ccsbBroad304_03245 pLX_304 0% 86.3% 87.8% V5 (many diffs) n/a
3 TRCN0000476569 AACGGACTTGCCTCCATAAGCTCG pLX_317 53.8% 86.3% 87.8% V5 (many diffs) n/a
Download CSV