Transcript: Mouse NM_019826.3

Mus musculus isovaleryl coenzyme A dehydrogenase (Ivd), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ivd (56357)
Length:
2067
CDS:
22..1296

Additional Resources:

NCBI RefSeq record:
NM_019826.3
NBCI Gene record:
Ivd (56357)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019826.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041421 GCTGATATCCTAGTCGTGTAT pLKO.1 628 CDS 100% 4.950 3.960 N Ivd n/a
2 TRCN0000308667 GCTGATATCCTAGTCGTGTAT pLKO_005 628 CDS 100% 4.950 3.960 N Ivd n/a
3 TRCN0000041420 CGCTTTCTACGAGATGCCAAA pLKO.1 1198 CDS 100% 4.050 3.240 N Ivd n/a
4 TRCN0000308725 CGCTTTCTACGAGATGCCAAA pLKO_005 1198 CDS 100% 4.050 3.240 N Ivd n/a
5 TRCN0000041419 GCTTCGTCATACTATATCTAA pLKO.1 168 CDS 100% 5.625 3.938 N Ivd n/a
6 TRCN0000308668 GCTTCGTCATACTATATCTAA pLKO_005 168 CDS 100% 5.625 3.938 N Ivd n/a
7 TRCN0000041418 CCGAGCTTTCAATGCAGACTT pLKO.1 1269 CDS 100% 4.950 3.465 N Ivd n/a
8 TRCN0000308731 CCGAGCTTTCAATGCAGACTT pLKO_005 1269 CDS 100% 4.950 3.465 N Ivd n/a
9 TRCN0000026587 CACAGCCTTCATTGTGGAGAA pLKO.1 690 CDS 100% 4.050 2.835 N IVD n/a
10 TRCN0000331034 CACAGCCTTCATTGTGGAGAA pLKO_005 690 CDS 100% 4.050 2.835 N IVD n/a
11 TRCN0000041422 GCACAGAAAGAGAAATACCTT pLKO.1 454 CDS 100% 3.000 2.100 N Ivd n/a
12 TRCN0000308666 GCACAGAAAGAGAAATACCTT pLKO_005 454 CDS 100% 3.000 2.100 N Ivd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019826.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10434 pDONR223 98.9% 86.9% 89.4% None (many diffs) n/a
2 ccsbBroad304_10434 pLX_304 0% 86.9% 89.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV