Transcript: Human NM_019841.7

Homo sapiens transient receptor potential cation channel subfamily V member 5 (TRPV5), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
TRPV5 (56302)
Length:
2890
CDS:
288..2477

Additional Resources:

NCBI RefSeq record:
NM_019841.7
NBCI Gene record:
TRPV5 (56302)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_019841.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001931 GCCTCCGCGTTCTATATCATT pLKO.1 1800 CDS 100% 5.625 7.875 N TRPV5 n/a
2 TRCN0000001928 CATGTATTTCACTCGAGGATT pLKO.1 1682 CDS 100% 0.000 0.000 N TRPV5 n/a
3 TRCN0000009930 CCTCCGCGTTCTATATCATTT pLKO.1 1801 CDS 100% 13.200 9.240 N TRPV5 n/a
4 TRCN0000009929 ATGCGGCTCACCAACACCAAT pLKO.1 1611 CDS 100% 4.950 3.465 N TRPV5 n/a
5 TRCN0000001929 GAGAACCACAATGATCAGAAT pLKO.1 2187 CDS 100% 4.950 3.465 N TRPV5 n/a
6 TRCN0000001930 CCTGCTCTACATGATCTGCTT pLKO.1 1295 CDS 100% 2.640 1.848 N TRPV5 n/a
7 TRCN0000010669 GTGTCTAACTTCTGTGCCTGT pLKO.1 2557 3UTR 100% 2.160 1.512 N TRPV5 n/a
8 TRCN0000009928 TGACGTTCGACAAAGAGGAGC pLKO.1 497 CDS 100% 2.160 1.512 N TRPV5 n/a
9 TRCN0000009931 CACTGCTCATGCTCAACTTGT pLKO.1 1987 CDS 100% 4.950 2.970 N TRPV5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019841.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12302 pDONR223 100% 52% 51.4% None (many diffs) n/a
2 ccsbBroad304_12302 pLX_304 0% 52% 51.4% V5 (many diffs) n/a
3 TRCN0000468821 ATTATGAACAACCGATGGCCAATC pLX_317 32.5% 52% 51.4% V5 (many diffs) n/a
Download CSV