Transcript: Mouse NM_019916.2

Mus musculus T cell leukemia, homeobox 3 (Tlx3), mRNA.

Source:
NCBI, updated 2019-06-07
Taxon:
Mus musculus (mouse)
Gene:
Tlx3 (27140)
Length:
1532
CDS:
130..1005

Additional Resources:

NCBI RefSeq record:
NM_019916.2
NBCI Gene record:
Tlx3 (27140)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019916.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018028 CGCGGGATCTTACAGTGTCAA pLKO.1 345 CDS 100% 4.950 6.930 N TLX3 n/a
2 TRCN0000070953 GCGCTCGCAAAGTCCCTCAAA pLKO.1 721 CDS 100% 1.650 2.310 N Tlx3 n/a
3 TRCN0000070955 CCGGACGCCACCCAAGCGTAA pLKO.1 609 CDS 100% 0.000 0.000 N Tlx3 n/a
4 TRCN0000436106 GATCTTACAGTGTCAACCTAA pLKO_005 350 CDS 100% 4.950 3.960 N Tlx3 n/a
5 TRCN0000420361 CCTGACAAAGAAGCGCCTTAC pLKO_005 1237 3UTR 100% 6.000 4.200 N Tlx3 n/a
6 TRCN0000070954 GCTTTGTAAAGGACCGCTTCA pLKO.1 527 CDS 100% 4.050 2.835 N Tlx3 n/a
7 TRCN0000070957 CCCGCACGAGCCCATCAGCTT pLKO.1 162 CDS 100% 0.000 0.000 N Tlx3 n/a
8 TRCN0000070956 CCGGCTCATGCTACAGCTGCA pLKO.1 840 CDS 100% 0.000 0.000 N Tlx3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019916.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03131 pDONR223 100% 95.1% 99.6% None (many diffs) n/a
2 ccsbBroad304_03131 pLX_304 0% 95.1% 99.6% V5 (many diffs) n/a
3 TRCN0000468404 CTGAGAATCGAGCATCCTCACCCA pLX_317 44% 95.1% 99.6% V5 (many diffs) n/a
Download CSV