Transcript: Mouse NM_019941.2

Mus musculus zinc finger protein 235 (Zfp235), mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
Zfp235 (56525)
Length:
3521
CDS:
369..2477

Additional Resources:

NCBI RefSeq record:
NM_019941.2
NBCI Gene record:
Zfp235 (56525)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019941.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426347 ATGTCAGAAATTACGTATAAG pLKO_005 2757 3UTR 100% 13.200 18.480 N Zfp235 n/a
2 TRCN0000086473 CCCTGCAAGTAAGGCTCAAAT pLKO.1 3040 3UTR 100% 13.200 18.480 N Zfp235 n/a
3 TRCN0000086474 GCGCTTCAACTGGAGTTTGAA pLKO.1 1910 CDS 100% 0.563 0.788 N Zfp235 n/a
4 TRCN0000086475 GCAGGTCCTCTTAGGAAATAA pLKO.1 1112 CDS 100% 15.000 12.000 N Zfp235 n/a
5 TRCN0000414496 GAAGCACAGATCTCAACATTC pLKO_005 1417 CDS 100% 10.800 7.560 N Zfp235 n/a
6 TRCN0000434159 GAGTCTCACAAGCGATCATTC pLKO_005 749 CDS 100% 10.800 7.560 N Zfp235 n/a
7 TRCN0000239756 ACAGGAGAGAAGCCATATAAG pLKO_005 1536 CDS 100% 13.200 6.600 Y Gm11677 n/a
8 TRCN0000239755 GTGGGAAGCGCTTCAGCTTAA pLKO_005 1651 CDS 100% 10.800 5.400 Y Gm11677 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019941.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.