Transcript: Mouse NM_019978.3

Mus musculus doublecortin-like kinase 1 (Dclk1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Dclk1 (13175)
Length:
7865
CDS:
247..2517

Additional Resources:

NCBI RefSeq record:
NM_019978.3
NBCI Gene record:
Dclk1 (13175)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019978.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321860 TACTCGAAGTCCTAGCTTAAC pLKO_005 2529 3UTR 100% 10.800 15.120 N Dclk1 n/a
2 TRCN0000221256 CCATCTCCGTATTGGGACAAT pLKO.1 2119 CDS 100% 4.950 6.930 N Dclk1 n/a
3 TRCN0000321859 CCATCTCCGTATTGGGACAAT pLKO_005 2119 CDS 100% 4.950 6.930 N Dclk1 n/a
4 TRCN0000221253 CCCAACATTGTCCTCCTGATT pLKO.1 1630 CDS 100% 4.950 6.930 N Dclk1 n/a
5 TRCN0000221254 GCTGTTGTCAAGGAATGTATA pLKO.1 1498 CDS 100% 13.200 9.240 N Dclk1 n/a
6 TRCN0000321795 GCTGTTGTCAAGGAATGTATA pLKO_005 1498 CDS 100% 13.200 9.240 N Dclk1 n/a
7 TRCN0000221255 GCCCTTTAAGAAGCTGGAGTA pLKO.1 651 CDS 100% 4.050 2.835 N Dclk1 n/a
8 TRCN0000221257 GACCGCTACTTCAAAGGAATT pLKO.1 442 CDS 100% 0.000 0.000 N Dclk1 n/a
9 TRCN0000321857 GACCGCTACTTCAAAGGAATT pLKO_005 442 CDS 100% 0.000 0.000 N Dclk1 n/a
10 TRCN0000002147 GCGCCATCAAATACCTGCATA pLKO.1 1784 CDS 100% 4.950 6.930 N DCLK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019978.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.