Transcript: Mouse NM_019992.4

Mus musculus signal transducing adaptor family member 1 (Stap1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Stap1 (56792)
Length:
1225
CDS:
93..986

Additional Resources:

NCBI RefSeq record:
NM_019992.4
NBCI Gene record:
Stap1 (56792)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019992.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105852 ACAATCTATGTTGGCAAGTTA pLKO.1 279 CDS 100% 5.625 7.875 N Stap1 n/a
2 TRCN0000105850 CATGACACCTTTCTTCATTTA pLKO.1 992 3UTR 100% 13.200 9.240 N Stap1 n/a
3 TRCN0000105851 CGAGGGAATTTGAGACCATTT pLKO.1 879 CDS 100% 10.800 7.560 N Stap1 n/a
4 TRCN0000105853 CACCAGGAGTACAAACACTAT pLKO.1 207 CDS 100% 4.950 3.465 N Stap1 n/a
5 TRCN0000065087 CCTGTAACACTCCCAAACCTT pLKO.1 825 CDS 100% 3.000 2.100 N STAP1 n/a
6 TRCN0000105854 GCTGATGACAACTTTGGTCAA pLKO.1 909 CDS 100% 4.050 2.430 N Stap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019992.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02933 pDONR223 100% 84.2% 83.1% None (many diffs) n/a
2 ccsbBroad304_02933 pLX_304 0% 84.2% 83.1% V5 (many diffs) n/a
3 TRCN0000491944 CCAGCCGGTCTCAAAACAGGCGGT pLX_317 36.7% 84.2% 83.1% V5 (many diffs) n/a
Download CSV