Transcript: Mouse NM_019996.4

Mus musculus phosphorylated adaptor for RNA export (Phax), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Phax (56698)
Length:
1893
CDS:
170..1327

Additional Resources:

NCBI RefSeq record:
NM_019996.4
NBCI Gene record:
Phax (56698)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019996.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305129 TGCGCACCGGTGTCACATTAT pLKO_005 293 CDS 100% 13.200 18.480 N Phax n/a
2 TRCN0000125910 CCGATGACGATTGCTCTCTTT pLKO.1 357 CDS 100% 4.950 6.930 N Phax n/a
3 TRCN0000315567 CCGATGACGATTGCTCTCTTT pLKO_005 357 CDS 100% 4.950 6.930 N Phax n/a
4 TRCN0000125909 CGGCACGGGTTAAATCTCATT pLKO.1 1513 3UTR 100% 4.950 6.930 N Phax n/a
5 TRCN0000305130 GTGTACTGAGACTAGAGAAAG pLKO_005 1402 3UTR 100% 10.800 8.640 N Phax n/a
6 TRCN0000125912 CCTATAACTATTTGCTTGCTA pLKO.1 591 CDS 100% 3.000 2.400 N Phax n/a
7 TRCN0000125913 GTCTGAGACCTATAACTATTT pLKO.1 583 CDS 100% 13.200 9.240 N Phax n/a
8 TRCN0000308480 GTCTGAGACCTATAACTATTT pLKO_005 583 CDS 100% 13.200 9.240 N Phax n/a
9 TRCN0000125911 GCCATTGAACTTCTGATGGAA pLKO.1 914 CDS 100% 3.000 2.100 N Phax n/a
10 TRCN0000308481 GCCATTGAACTTCTGATGGAA pLKO_005 914 CDS 100% 3.000 2.100 N Phax n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019996.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14156 pDONR223 100% 81.6% 84.8% None (many diffs) n/a
2 ccsbBroad304_14156 pLX_304 0% 81.6% 84.8% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000467933 CGGATACTACGACGTCTTTCTTTA pLX_317 33.9% 81.6% 84.8% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV