Transcript: Human NM_020232.5

Homo sapiens proteasome assembly chaperone 2 (PSMG2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
PSMG2 (56984)
Length:
1070
CDS:
67..861

Additional Resources:

NCBI RefSeq record:
NM_020232.5
NBCI Gene record:
PSMG2 (56984)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020232.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147854 GCATTAGGTCTTGTTGAGTAT pLKO.1 715 CDS 100% 4.950 6.930 N PSMG2 n/a
2 TRCN0000323360 GCATTAGGTCTTGTTGAGTAT pLKO_005 715 CDS 100% 4.950 6.930 N PSMG2 n/a
3 TRCN0000323293 CTTGCAATGGATCTGATTATT pLKO_005 154 CDS 100% 15.000 10.500 N PSMG2 n/a
4 TRCN0000323373 AGTCATTCATATCAGCGTAAT pLKO_005 436 CDS 100% 10.800 7.560 N PSMG2 n/a
5 TRCN0000148252 CCAACACAGCTGTTAAACATT pLKO.1 903 3UTR 100% 5.625 3.938 N PSMG2 n/a
6 TRCN0000323358 CCAACACAGCTGTTAAACATT pLKO_005 903 3UTR 100% 5.625 3.938 N PSMG2 n/a
7 TRCN0000183205 GCTCTACAGTTAAGATCCATT pLKO.1 325 CDS 100% 4.950 3.465 N PSMG2 n/a
8 TRCN0000147080 CAGTCATTCATATCAGCGTAA pLKO.1 435 CDS 100% 4.050 2.835 N PSMG2 n/a
9 TRCN0000147014 CTTCAGATACTCAAACCACTT pLKO.1 748 CDS 100% 4.050 2.430 N PSMG2 n/a
10 TRCN0000323359 CTTCAGATACTCAAACCACTT pLKO_005 748 CDS 100% 4.050 2.430 N PSMG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020232.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08680 pDONR223 100% 99.8% 100% None 303A>G n/a
2 ccsbBroad304_08680 pLX_304 0% 99.8% 100% V5 303A>G n/a
3 TRCN0000474331 CGCGCAAGGTTAAGCCTCATGTAG pLX_317 45.4% 99.8% 100% V5 303A>G n/a
Download CSV