Transcript: Mouse NM_020278.2

Mus musculus leucine-rich repeat LGI family, member 1 (Lgi1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Lgi1 (56839)
Length:
4285
CDS:
102..1775

Additional Resources:

NCBI RefSeq record:
NM_020278.2
NBCI Gene record:
Lgi1 (56839)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_020278.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216344 GTAGCAAAGATAACGCTTTAT pLKO.1 244 CDS 100% 13.200 18.480 N Lgi1 n/a
2 TRCN0000191906 GCTCTTGTTATTTACGTCGAA pLKO.1 383 CDS 100% 2.640 3.696 N Lgi1 n/a
3 TRCN0000191043 CCTCAGAACACCTCATTTAAT pLKO.1 1280 CDS 100% 15.000 10.500 N Lgi1 n/a
4 TRCN0000217612 GAGAAGACCTTCCGGAATTAT pLKO.1 906 CDS 100% 15.000 10.500 N Lgi1 n/a
5 TRCN0000191940 GCAGTGAAGATGTGTAAATAA pLKO.1 1997 3UTR 100% 15.000 10.500 N Lgi1 n/a
6 TRCN0000378822 CACCGTTCCTCCTGATGTTAT pLKO_005 290 CDS 100% 13.200 9.240 N LGI1 n/a
7 TRCN0000189611 CCAGATTCATTGGCGACTCTA pLKO.1 1447 CDS 100% 4.950 3.465 N Lgi1 n/a
8 TRCN0000200537 CGCATTTAATTGTGACTGTAA pLKO.1 620 CDS 100% 4.950 3.465 N Lgi1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020278.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02107 pDONR223 100% 91.9% 96.9% None (many diffs) n/a
2 ccsbBroad304_02107 pLX_304 0% 91.9% 96.9% V5 (many diffs) n/a
Download CSV