Transcript: Human NM_020312.4

Homo sapiens coenzyme Q9 (COQ9), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
COQ9 (57017)
Length:
1630
CDS:
28..984

Additional Resources:

NCBI RefSeq record:
NM_020312.4
NBCI Gene record:
COQ9 (57017)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020312.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136323 CCGGGTTAATGATGCAATGAA pLKO.1 852 CDS 100% 5.625 3.938 N COQ9 n/a
2 TRCN0000281374 CCGGGTTAATGATGCAATGAA pLKO_005 852 CDS 100% 5.625 3.938 N COQ9 n/a
3 TRCN0000137649 CCTGATCCAGAGTCTTCTCAT pLKO.1 238 CDS 100% 4.950 3.465 N COQ9 n/a
4 TRCN0000281299 CCTGATCCAGAGTCTTCTCAT pLKO_005 238 CDS 100% 4.950 3.465 N COQ9 n/a
5 TRCN0000136378 CTATGAAAGTGAGGAGCAGTT pLKO.1 303 CDS 100% 4.050 2.835 N COQ9 n/a
6 TRCN0000184656 GAAGAGGAAGACAGACCAGTT pLKO.1 549 CDS 100% 4.050 2.835 N Coq9 n/a
7 TRCN0000138126 GCGGACAGATTGAAAGAGCTT pLKO.1 1024 3UTR 100% 2.640 1.848 N COQ9 n/a
8 TRCN0000281296 GCGGACAGATTGAAAGAGCTT pLKO_005 1024 3UTR 100% 2.640 1.848 N COQ9 n/a
9 TRCN0000138923 GCTAAGGTCTTCAGATGAGCA pLKO.1 156 CDS 100% 2.640 1.848 N COQ9 n/a
10 TRCN0000138364 CTACAACACAACAGAGCTGGT pLKO.1 777 CDS 100% 2.160 1.512 N COQ9 n/a
11 TRCN0000281375 CTACAACACAACAGAGCTGGT pLKO_005 777 CDS 100% 2.160 1.512 N COQ9 n/a
12 TRCN0000137877 CAGTGGAAACCAGACTGAGAA pLKO.1 581 CDS 100% 4.950 2.970 N COQ9 n/a
13 TRCN0000135882 GCAGTGAGCTAATACTGCATT pLKO.1 452 CDS 100% 0.495 0.297 N COQ9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020312.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03771 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03771 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468128 GTATACTTGTCGACCCACTTTTAG pLX_317 43.2% 100% 100% V5 n/a
Download CSV